AJP - Lung Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 291: L66-L74, 2006. First published April 14, 2006; doi:10.1152/ajplung.00384.2005
1040-0605/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/1/L66    most recent
00384.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Issa, R.
Right arrow Articles by Chung, K. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Issa, R.
Right arrow Articles by Chung, K. F.

GRO-{alpha} regulation in airway smooth muscle by IL-1beta and TNF-{alpha}: role of NF-{kappa}B and MAP kinases

Razao Issa,1 Shaoping Xie,1 Kang-Yun Lee,1 Rex D. Stanbridge,2 Pankaj Bhavsar,1 Maria B. Sukkar,1 and Kian Fan Chung1

1Experimental Studies, National Heart and Lung Institute, Imperial College, and 2Cardiothoracic Surgery, St. Mary's Hospital, London, United Kingdom

Submitted 8 September 2005 ; accepted in final form 6 December 2005


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Airway smooth muscle cells (ASMC) are a source of inflammatory chemokines that may propagate airway inflammatory responses. We investigated the production of the CXC chemokine growth-related oncogene protein-{alpha} (GRO-{alpha}) from ASMC induced by cytokines and the role of MAPK and NF-{kappa}B pathways. ASMC were cultured from human airways, grown to confluence, and exposed to cytokines IL-1beta and TNF-{alpha} after growth arrest. GRO-{alpha} release, measured by ELISA, was increased by >50-fold after IL-1beta (0.1 ng/ml) or 5-fold after TNF-{alpha} (1 ng/ml) in a dose- and time-dependent manner. GRO-{alpha} release was not affected by the T helper type 2 cytokines IL-4, IL-10, and IL-13. IL-1beta and TNF-{alpha} also induced GRO-{alpha} mRNA expression. Supernatants from IL-1beta-stimulated ASMC were chemotactic for neutrophils; this effect was inhibited by anti-GRO-{alpha} blocking antibody. AS-602868, an inhibitor of IKK-2, and PD-98059, an inhibitor of ERK, inhibited GRO-{alpha} release and mRNA expression, whereas SP-600125, an inhibitor of JNK, reduced GRO-{alpha} release without effect on mRNA expression. SB-203580, an inhibitor of p38 MAPK, had no effect. AS-602868 but not PD-98059 or SP-600125 inhibited p65 DNA-binding induced by IL-1beta and TNF-{alpha}. By chromatin immunoprecipitation assay, IL-1beta and TNF-{alpha} enhanced p65 binding to the GRO-{alpha} promoter, which was inhibited by AS-602868. IL-1beta- and TNF-{alpha}-stimulated expression of GRO-{alpha} from ASMC is regulated by independent pathways involving NF-{kappa}B activation and ERK and JNK pathways. GRO-{alpha} released from ASMC participates in neutrophil chemotaxis.

growth-related oncogene protein-{alpha}; extracellular signal-regulated kinase; c-Jun NH2-terminal kinase; nuclear factor-{kappa}B


HUMAN AIRWAY SMOOTH MUSCLE cells (ASMC), apart from having contractile and proliferative functions, may contribute directly to airway inflammation through their synthesis of proinflammatory cytokines and chemokines (6). ASMC in culture can be stimulated to produce a wide array of cytokines and chemokines such as granulocyte-macrophage colony-stimulating factor (GM-CSF), regulated on activation, normal T cell expressed, and secreted (RANTES), eotaxin, IL-6, and IL-8 in response to inflammatory mediators (7, 17, 18, 30, 35) and may therefore be important effector cells in lung inflammation. Using gene microarrays, we found that IL-1beta also induced the expression of the CXC chemokines growth-related oncogene protein (GRO)-{alpha}, -beta, and -{gamma} (16). GRO-{alpha} was first isolated and characterized by its growth stimulatory activity on malignant melanoma cells (28), and, similar to IL-8, it has neutrophil chemotactic activity with a major role in the recruitment and activation of neutrophils at sites of inflammation (23). However, there is little information on the regulation of GRO-{alpha} expression and release from ASMC.

MAPKs are a family of serine/threonine kinases that transduce extracellular signals to the nucleus. In mammalian cells, three major groups of MAPKs that differ in their substrate specificity have been characterized: ERK, JNK, and p38 MAPK. Activation of MAPKs requires dual phosphorylation on threonine and tyrosine by upstream kinases and occurs in response to diverse stimuli such as environmental stress, endotoxins, mitogenic stimuli, and proinflammatory cytokines (IL-1beta and TNF-{alpha}) (8, 19). Once activated, MAPKs phosphorylate selected intracellular proteins, including transcription factors that result in changes in gene expression that affect cellular processes such as proliferation, differentiation, survival, and inflammation. MAPKs participate in gene regulation and release of cytokines and chemokines from ASMC; for example, IL-8 protein release stimulated by IL-1beta, TNF-{alpha}, and IFN-{gamma} was partially blocked by the ERK inhibitor PD-98059 or by a p38 MAPK inhibitor, SB-203580 (9).

In the present study, we investigated the effect of proinflammatory cytokines IL-1beta and TNF-{alpha} in the induction and release of GRO-{alpha} from ASMC in culture and the role of GRO-{alpha} as a neutrophil chemoattractant. We also determined the role of MAPK pathways in the induction of GRO-{alpha} by using selective inhibitors of the ERK, JNK, and p38 MAPK pathways. In addition to the MAPK pathways, we also determined the role of the ubiquitous transcription factor NF-{kappa}B, as well as NF-{kappa}B p65 binding to GRO-{alpha} promoter. The GRO-{alpha} promoter region contains NF-{kappa}B DNA-binding sites (3), and NF-{kappa}B activation represents an important pathway mediating GRO-{alpha} secretion in several cell types. Both IL-1beta and TNF-{alpha} stimulate NF-{kappa}B activation in ASMC (2, 33), and TNF-{alpha}-induced expression of the chemokines IL-8 and eotaxin has been shown to be NF-{kappa}B dependent (25, 27).


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Reagents. All tissue culture reagents and chemicals were obtained from Sigma (Poole, UK) unless otherwise stated. Protease inhibitor cocktail was obtained from Roche Diagnostic (Lewes, UK). Cell culture plasticware was purchased from Falcon Labware (Becton Dickinson, Oxford, UK). Recombinant human IL-1beta, TNF-{alpha}, IL-4, IL-10, IL-13, GRO-{alpha}, anti-GRO-{alpha} antibody, and matched antibody pairs for GRO-{alpha} ELISA were purchased from R&D Systems (Abingdon, UK). The p38 MAPK inhibitor SB-203580 and the MEK inhibitor PD-98059 were purchased from Calbiochem (Nottingham, UK). The JNK inhibitor SP-600125 (4) was a gift from Dr. Brydon Bennett (Celgene, San Diego, CA) and the IKK-2 inhibitor AS-602868 (11) from Serono Laboratories (Basel, Switzerland). The antibodies for Western blotting (JNK, phospho-JNK, ERK, phospho-ERK, p38, phospho-p38, I{kappa}B-{alpha}, and phospho-I{kappa}B-{alpha}) were purchased from New England BioLabs (Beverly, MA).

Isolation of human ASMC. Human ASMC were dissected out from lobar or main bronchus obtained from patients undergoing lung resection for carcinoma of the bronchus, as previously described (26). The collection of human samples was approved by the Ethics Committees of the Royal Brampton Hospital and of St. Mary’s Hospital. Cells were maintained in DMEM containing 10% FCS supplemented with sodium pyruvate (1 mM), L-glutamine (2 mM), nonessential amino acids (1:100), penicillin (100 U/ml), streptomycin (100 µg/ml), and amphotericin B (1.5 µg/ml) in a humidified atmosphere at 37°C in air-CO2 (95%-5% vol/vol). Confluent cells were passaged with 0.25% trypsin and 1 mM EDTA. ASMC at passages 3–7 from nine different donors were used in the studies described below. ASMC were characterized by positive immunostaining for calponin, smooth muscle {alpha}-actin, and myosin heavy chain.

Measurement of GRO-{alpha} release. ASMC were plated at a seeding density of 1 x 104 cells/cm2 in 12-well plates. Confluent cells were serum deprived for 24 h in serum-free medium (SFM) consisting of DMEM supplemented with sodium pyruvate (1 mM), L-glutamine (2 mM), nonessential amino acids (1:100), penicillin (100 U/ml), streptomycin (100 µg/ml), amphotericin B (1.5 µg/ml), BSA (0.1%), and ascorbic acid (100 µM). Cells were stimulated in duplicate for 24 h in fresh SFM containing cytokines IL-1beta (0.001–10 ng/ml) or TNF-{alpha} (0.01–20 ng/ml). To examine whether the GRO-{alpha} release was time dependent, the cells were stimulated with IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml) at different time points from 1 h up to 72 h. The cells were also stimulated with IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml) alone or in the presence of T helper type 2 (Th-2) cytokines IL-4, IL-10, or IL-13, each at 10 ng/ml. After appropriate incubation times, the supernatants were collected and stored at –20°C. GRO-{alpha} levels were measured by using a dual-set ELISA kit (R&D Systems) according to the manufacturer's instructions. The samples were diluted until the cytokine level was within the linear range of the standard curve.

Neutrophil chemotaxis assay. Briefly, blood was collected into sterile heparinized syringes from the peripheral veins of normal donors after informed consent was obtained. Peripheral venous blood was mixed with acid-citrate dextrose (1:6 vol/vol) and sedimented on dextran (6% in 0.9% NaCl) for 40 min. The neutrophil fraction was obtained by plasma-Percoll density gradient centrifugation. Cells were washed twice with HBSS and resuspended (106 cells/ml) in complete chemotaxis buffer (RPMI plus 0.5% BSA).

Human neutrophil chemotaxis was measured in Falcon 24-well plates containing Transwell inserts (Corning Glass, Corning, NY). Chemotactic properties of supernatants taken from IL-1beta (0.1 ng/ml)-stimulated ASMC or nonstimulated controls were evaluated by measuring the neutrophil migration through a 3-µm polycarbonate filter. Transwell inserts containing 250 µl of purified cells (106 cells/ml) were placed in wells containing chemotaxis buffer only or GRO-{alpha} (10 ng/ml) or various dilutions of supernatants of unstimulated control or IL-1beta-stimulated ASMC at dilutions of 1:1, 1:15, and 1:50. Studies were also performed with or without prior incubation with neutralizing anti-GRO-{alpha} antibody for 15 min at room temperature. After 1.5 h of incubation at 37°C with 5% CO2, cells that transmigrated into the lower chamber were recovered by centrifugation. The number of migrated cells was determined with a colorimetric lactate dehydrogenase (LDH) assay (CytoTox 96 nonradioactive cytotoxicity assay; Promega, Madison, WI). Briefly, migrated cells were lysed with 1% Triton X-100 for 30 min, and the plates were centrifuged at 250 g for 12 min. The supernatants were transferred to an Immulon 96-well microtiter plate, the LDH assay reagents were added and incubated for 45 min, and the reaction was stopped and absorbance was measured at 490 nm. The LDH measurements from the effects of recombinant human GRO-{alpha} (10 ng/ml) was given a value of 100. Data are expressed as a percentage of the response to GRO-{alpha}.

RNA preparation and real-time PCR. Cells were plated at a seeding density of 1 x 104 cells/cm2 in six-well plates. The 24-h serum-deprived confluent cells were stimulated in duplicate with IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml) for 2 h, either alone or in the presence of PD-980590 (25 µM), SP-600125 (10 µM), or AS-602868 (2.5 µM) for 24 h. Cells were harvested and total RNA was isolated with the Qiagen RNase easy extraction kit (RNeasy Mini; Qiagen, Crawley, UK) according to the manufacturer's instructions.

First-strand cDNA was synthesized in a volume of 60 µl containing 0.5 µg of total RNA. For the real-time PCR, 5 µl of the RT-PCR first-strand cDNA and 0.5 µM of primers were used in a total 20-µl reaction containing 10 µl of Universal SYBRgreen Master mix (Qiagen). The primers used were: GRO-{alpha}, ATGGCCCGCGCTGCTCTCTCC (forward) and GTTGGATTTGTCACTGTTCAG (reverse); GAPDH, GAAGATGGTGATGGGATTTC (forward) and GAPDH GAAGGTGAAGGTCGGAGT (reverse). A known concentration of GAPDH cDNA was also used as a standard, using GAPDH primers to be amplified in parallel with the sample template. The conditions of the reaction were as follows: denaturing at 95°C for 15 min followed by a denaturing step (20 s at 94°C) and an annealing step (60°C for 20s) for 45 cycles. Determination of the expression of the housekeeping gene GAPDH was performed in a parallel tube, and all reactions were undertaken in duplicate. Target mRNA was normalized to GAPDH mRNA, expressed relative to control, which was given a value of 1 for each donor.

Effect of MAPK inhibitors on GRO-{alpha} release. Confluent serum-deprived ASMC were preincubated for 1 h with the JNK inhibitor SP-600125 (10–50 µM), the p38 inhibitor SB-203580 (0.5–2 µM), or the MEK inhibitor PD-98059 (10–50 µM), DMSO vehicle controls, or the diluents alone in fresh SFM before addition of IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml). The supernatants were collected 24 h after incubation at 37°C in a CO2 incubator and stored at –20°C. Colorimetric dyes 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) and crystal violet were used to measure the viability and the number of the remaining cells, respectively, in each plate.

Effect of NF-{kappa}B inhibition on GRO-{alpha} release. IKK-2 is essential for NF-{kappa}B activation, and to inhibit NF-{kappa}B activation we therefore studied the effect of an inhibitor of IKK-2, AS-602868. ASMC were preincubated for 1 h with AS-602868 (1–10 µM) or the DMSO diluent before addition of IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml). The supernatants were collected 24 h later.

Measurements of NF-{kappa}B activity. To determine the effect of AS-602868 in blocking NF-{kappa}B activity in human ASMC, an ELISA-based assay (TransAM Transcription Factor Assay Kit, Active Motif Europe) to determine the binding activity of p65, a component of NF-{kappa}B, was used. Serum-starved ASMC were pretreated with AS-602868 (1, 2.5, 5, and 10 µM) for 1 h before addition of either IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml) for 1 h. Briefly, 5 µg of nuclear protein samples was incubated for 1 h in a 96-well plate coated with an oligonucleotide that contains a p65 consensus site (5'-GGGACTTTCC-3'), to which phosphorylated p65 in nuclear extracts specifically binds. After washing, p65 antibody was added to these wells and incubated for 1 h. After incubation for 1 h with a secondary horseradish peroxidase (HRP)-conjugated antibody (1:1,000 dilution), specific binding was detected by colorimetric estimation at 450 nm with a reference wavelength of 655 nm.

Western blot of phosphorylated JNK, ERK, p38, and IKB-{alpha}. Confluent serum-deprived cells at a seeding density of 1 x 104 cells/cm2 in SFM for 24 h were preincubated for 1 h with IL-1beta (0.1 ng/ml) in the presence or absence of AS-602868 (1–2.5 µM), the MEK inhibitor PD-98059 (25 µM), or the JNK inhibitor SP-600125 (10 µM). The cells were collected after incubation for 15 min at 37°C in a CO2 incubator. The cells were rinsed with ice-cold PBS and lysed in radioimmunoprecipitation assay buffer [PBS containing 0.5% sodium deoxycholate, 0.1% SDS, 1% Igepal, 200 µM Na3VO4, and protease inhibitor cocktail (1 tablet/10 ml buffer)]. Cells were scraped off the wells and solubilized by sonication followed by centrifugation (10,000 g, 4°C, 4 min). Protein concentrations were determined with a protein assay kit (Pierce Chemical, Rockford, IL).

Total protein extracts heated at 90°C for 5 min were separated by SDS-PAGE (20 µg/lane) using 4–12% polyacrylamide precast gel (Novex, Invitrogen, Paisley, UK), transferred to membranes, and blotted with anti-phosphorylated threonine and tyrosine residues of JNK, p38 MAP, and p42/p44 MAPK (1:1,000), according to the manufacturer's instructions (New England Biolabs). After washing with phosphate-buffered saline and Tween 20 mixture (PBS/T), the membrane was incubated with HRP-conjugated secondary antibody (goat anti-rabbit IgG; 1:2,000) for 1 h at room temperature. Membranes were thoroughly washed with PBS/T and visualized by enhanced chemiluminescence (LumiGLO; KPL Europe, Guildford, UK). The membranes were reprobed with phosphorylation state-independent anti-JNK, anti-p38, and anti-ERK antibodies. To confirm equal protein loading, a mouse anti-GAPDH monoclonal antibody (1:20,000) was also applied.

Band intensities on autoradiographs were quantified with software from Ultra-Violet Products (Cambridge, UK). Densitometric data for the phosphorylated band were normalized for equal loading by dividing the phosphorylated value by the total nonphosphorylated band and then normalized to unstimulated control cells, which were set to 1.0.

Chromatin immunoprecipitation assay. The chromatin immunoprecipitation (ChIP) assay is a powerful technique to determine true in vivo binding of transcription factors and other nucleosomal proteins to chromatin in response to an agonist. We used this assay to determine the status of the NF-{kappa}B transcription complex at the promoters of key NF-{kappa}B-regulated genes in ASMC in response to IL-1beta or TNF-{alpha}.

Serum-starved ASMC were pretreated with either DMEM containing AS-602868 (2.5 µM) or DMEM alone for 1 h before addition of either IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml) for an additional 2 h. After stimulation, protein-DNA complexes were cross-linked by formaldehyde (1% final concentration). Cells were resuspended in 200 µl of SDS lysis buffer (50 mM Tris, pH 8.1, 1% SDS, 5 mM EDTA, complete proteinase inhibitor mixture). The suspension was subjected to five cycles of sonication on ice with 10-s pulses followed by centrifugation for 10 min. Supernatants were collected, and one-tenth of the total lysate was used for total genomic DNA as "input DNA" control. The rest of the supernatants were diluted in buffer (1% Triton X-100, 2 mM EDTA, 150 mM NaCl, 20 mM Tris·HCl, pH 8.1, 1x protease inhibitor mixture) followed by immunoclearing with 1 µg of sheared salmon sperm DNA, and 20 µl of protein A-Sepharose (Upstate Biotechnology) for 30 min at 4°C. The soluble chromatin solution was immunoprecipitated by using antibodies specific for p65 (Santa Cruz Biotechnology, Santa Cruz, CA). Protein-bound immunoprecipitated DNA was washed with LiCl wash buffer and 10 mM Tris-1 mM EDTA, pH 8.0 buffer, and immune complexes were eluted by adding elution buffer (1% SDS, 0.1 M NaHCO3). Eluates were pooled and heated at 65°C for at least 4 h in 200 mM NaCl-1% SDS to reverse the formaldehyde cross-linking. This was followed by incubation for 1 h at 45°C with 70 µg/ml proteinase K (Sigma). DNA fragments were purified with phenol-chloroform followed by precipitation with ethanol-0.3 M NaHCOOH-20 µg glycogen. The pellet was resuspended in nuclease-free water. Quantitative PCR was performed with DNA samples from both samples and input for quantifications. Real-time PCR was performed in a Rotor-Gene 3000TM four-channel multiplexing system (Corbett Research, Sydney, Australia), using a QuantiTect SYBRgreen PCR Kit (Qiagen) to quantify the immunoprecipitated DNA from ChIP assays. The PCR primers correspond to sequences within the promoter regions as follows: GRO-{alpha} forward (5'-CGT CGC CTT CCT TCC GGA CTC G-3') and reverse (5'-GCT CTC CGA GAT CCG CGA ACCC-3'). Cycle parameters were 95°C for 15 min to activate HotStarTaq DNA Polymerase, followed by annealing and extension at 45 cycles of 94°C for 15 s, 60°C for 25 s, and 72°C for 25 s. The samples were normalized with each corresponding input. Data are expressed relative to the untreated control, which was given a value of 1 for each donor.

Data analysis. Data are presented as means ± SE. Data were compared with one-way ANOVA followed by Newman-Keuls post hoc test to determine statistical differences after multiple comparisons. A P value of <0.05 was considered significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
IL-1beta and TNF-{alpha} induce GRO-{alpha} release and expression. ASMC cultured in medium alone for 24 h released GRO-{alpha} into the culture supernatant, but this was increased after stimulation with IL-1beta (0.001–10 ng/ml) or TNF-{alpha} (0.01–20 ng/ml) (Fig. 1A). Both induced GRO-{alpha} release compared with GRO-{alpha} released from control in a dose-dependent manner. Near-maximal release occurred with 0.1 ng/ml IL-1beta and after 72 h of stimulation, when the release was still increasing (Fig. 1B). The difference in amounts of GRO-{alpha} released with IL-1beta stimulation (0.1 ng/ml) shown in Fig. 1, A and B, illustrates the variability of the response of ASMC from the different donors used in the two experiments. TNF-{alpha} stimulation caused near-maximal GRO-{alpha} release at 1 ng/ml and at 72 h (Fig. 1). IL-1beta was more potent in inducing GRO-{alpha} than TNF-{alpha}. There was further increase in GRO-{alpha} release when IL-1beta (0.1 ng/ml) and TNF-{alpha} (1 ng/ml) were added together compared with each cytokine alone (see GoFig. 3A).


Figure 1
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 1. Effect of increasing concentrations of IL-1beta and TNF-{alpha} at 24 h (A) and time course (B) on growth-related oncogene protein-{alpha} (GRO-{alpha}) release. C: GRO-{alpha} mRNA expression stimulated by IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml) at 2 h, as measured by real-time PCR. The expression of GRO-{alpha} is expressed as a ratio with GAPDH, with the untreated control given a value of 1. Results are means ± SE of experiments from 4 or 5 different donors. *P < 0.05, **P < 0.01, ***P < 0.001 compared with the unstimulated control.

 

Figure 3
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. A: effect of supernatants from IL-1beta-stimulated airway smooth muscle cells or nonstimulated cells (control supernatant) at different dilutions on chemotaxis of human neutrophils in vitro. Data are means ± SE from 3 different airway smooth muscle donors. Neutrophil migration index is related to the effect of GRO-{alpha} (10 ng/ml) alone. B: effect of anti-GRO-{alpha} neutralizing antibody on neutrophil migration induced by GRO-{alpha} (10 ng/ml) or by supernatants taken from IL-1beta-treated airway smooth muscle cells. *P < 0.05 compared with chemotaxis induced by GRO-{alpha} alone; **P < 0.01 compared with chemotaxis induced by supernatant from IL-1beta-stimulated airway smooth muscle cells set at 100%.

 
GRO-{alpha} mRNA expression significantly increased after IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml) stimulation over the nonstimulated controls at 2 h (Fig. 1C). GRO-{alpha} mRNA expression was also increased (P < 0.01, n = 4) after treatment with a mixture of IL-1beta and TNF-{alpha} over stimulation with each cytokine alone (Fig. 1C).

To determine whether the IL-1beta and TNF-{alpha} effect on GRO-{alpha} expression was protein synthesis dependent, ASMC were pretreated with the protein synthesis inhibitor cycloheximide (10 µg/ml; 30 min) before cytokine treatment. IL-1beta and TNF-{alpha} induced GRO-{alpha} mRNA. The addition of cycloheximide alone caused superinduction of GRO-{alpha} mRNA expression. Cycloheximide together with each cytokine induced significantly higher GRO-{alpha} mRNA than in the presence of each cytokine alone at 24 h (P < 0.01, n = 5; Fig. 2A). Similar data were also observed at 2 h (not shown). Cycloheximide significantly inhibited both IL-1beta (P < 0.001, n = 6)- and TNF-{alpha} (P < 0.001, n = 4)-induced GRO-{alpha} release at 24 h (Fig. 2B).


Figure 2
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. Effect of cycloheximide (CHX) on IL-1beta (0.1 ng/ml)- or TNF-{alpha} (1 ng/ml)-stimulated GRO-{alpha} mRNA expression (A) and GRO-{alpha} release at 24 h (B). A: CHX increased IL-1beta- and TNF-{alpha}-induced GRO-{alpha} mRNA expression. Data are means ± SE for IL-1beta and TNF-{alpha} (n = 5 each). Expression of GRO-{alpha} is expressed as a ratio with GAPDH, with cytokine treatment alone given a value of 1. **P < 0.01 compared with cytokine treated only. B: CHX inhibited GRO-{alpha} release. Data are expressed as % of the control response to either IL-1beta or TNF-{alpha} alone. Data are means ± SE for n = 6 (IL-1beta) or 4 (TNF-{alpha}). ***P < 0.001 compared with IL-1beta- or TNF-{alpha}-induced release at 100%.

 
Effect of IL-1beta-stimulated ASMC supernatants on neutrophil chemotaxis. Neutrophil chemotaxis assay was performed to determine whether the GRO-{alpha} released after IL-1beta stimulation was biologically active. Supernatants taken from IL-1beta (0.1 ng/ml)-stimulated ASMC for 24 h induced neutrophil chemotaxis with a threefold increase compared with supernatants taken from nonstimulated ASMC (Fig. 3A). Although there was more neutrophil chemotaxis at the 1:15 dilution, there was overall little difference between the 1:1, 1:15, and 1:50 dilutions of the supernatants. The neutralizing anti-GRO-{alpha} antibody significantly reduced neutrophil chemotaxis of supernatant from IL-1beta-treated ASMC (P < 0.001, n = 4; Fig. 3B). These data indicate that IL-1beta-mediated ASMC release of GRO-{alpha} may participate in neutrophil recruitment.

Effect of IL-4, IL-10, and IL-13 on GRO-{alpha} release. The Th-2 cytokines IL-4, IL-10, and IL-13 had no significant effect on the baseline release of GRO-{alpha} (n = 5). These cytokines also did not alter the stimulatory effect of IL-1beta or TNF-{alpha} on GRO-{alpha} release (data not shown).

Effect of MAPK inhibitors on GRO-{alpha} release and expression. The JNK inhibitor SP-600125 attenuated both IL-1beta- and TNF-{alpha}-induced GRO-{alpha} release in a dose-dependent manner (P < 0.001, n = 7; Fig. 4A). Similarly, the MEK inhibitor PD-98059 reduced GRO-{alpha} release induced by IL-1beta (at 25 µM P < 0.01, at 50 µM P < 0.001; n = 5) (Fig. 4B). PD-98059 also inhibited TNF-{alpha}-induced GRO-{alpha} release (at 10 µM P < 0.01, at 50 µM P < 0.001; n = 4) (Fig. 4B). The inhibitory effect of the p38 inhibitor SB-203580 on GRO-{alpha} release was minor, being only significant at 1 µM (P < 0.05, n = 8) but not at 2 µM (Fig. 4C). Only PD-98059 significantly inhibited GRO-{alpha} mRNA expression induced by IL-1beta (P < 0.01, n = 6) and by TNF-{alpha} (P < 0.05, n = 5). SP-600125 had no significant effect on GRO-{alpha} mRNA expression (Fig. 4D). The apparent increase in IL-1beta-induced GRO-{alpha} mRNA in the presence of SP-600125 was due to one of the six donors studied.


Figure 4
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4. Effect of JNK inhibitor (SP-600125, A), MEK inhibitor (PD-98059, B) or p38 inhibitor (SB-203580, C) on GRO-{alpha} release induced by IL-1beta (0.1 ng/ml) or TNF-{alpha} (1 ng/ml). Data are expressed as % of the control response to either IL-1beta or TNF-{alpha} alone and are means ± SE of 4–8 donors. *P < 0.05, **P < 0.01, ***P < 0.001 compared with IL-1beta- or TNF-{alpha}-induced release at 100%. D: effect of SP-600125 or PD-98059 on IL-1beta (n = 6)- and TNF-{alpha} (n = 5)-induced GRO-{alpha} mRNA expression. Data are means ± SE. The expression of GRO-{alpha} is expressed as a ratio with GAPDH, with cytokines treated alone given a value of 1. *P < 0.05; **P < 0.01 compared with cytokine treated only.

 
Effect of IKK-2 inhibitor on GRO-{alpha} release and expression. AS-602868 caused a concentration-dependent inhibition of GRO-{alpha} release induced by both IL-1beta (P < 0.001, n = 6; Fig. 5A) and TNF-{alpha} (at 1 µM P < 0.05, at 2.5 µM P < 0.01, at 5 µM and 10 µM P < 0.001; n = 6; Fig. 5B). This inhibitor also inhibited GRO-{alpha} mRNA expression (P < 0.001, n = 4; Fig. 5C). Cell viability was not changed by AS-602868.


Figure 5
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 5. Effect of IKK-2 inhibitor AS-602868 on IL-1beta- or TNF-{alpha}-induced GRO-{alpha} release. Data are expressed as % of the control response to either IL-1beta (A) or TNF-{alpha} (B) and are means ± SE of 6 donors. *P < 0.05, **P < 0.01, ***P < 0.001 compared with cytokine treated only. C: effect of AS-602868 on IL-1beta- and TNF-{alpha}-induced GRO-{alpha} mRNA expression. The expression of GRO-{alpha} is expressed as a ratio with GAPDH, with cytokines treated alone given a value of 1. Data are means ± SE of 4 donors. ***P < 0.001. D: effect of AS-602868, PD-98059, and both together on IL-1beta-induced GRO-{alpha} release. Data are means ± SE of 4 donors. **P < 0.01.

 
To determine whether the NF-{kappa}B and ERK pathways were activated simultaneously but independently by IL-1beta, we examined the effect of both inhibitors on GRO-{alpha} release. We found that in the presence of both inhibitors at the submaximal doses (AS-602868 2 µM and PD-98059 10 µM), there was significantly more suppression of GRO-{alpha} release than in the presence of either inhibitor alone (Fig. 5D).

Effect of inhibitors on IL-1beta- and TNF-{alpha}-induced NF-{kappa}B activation. p65 binding was increased by IL-1beta after 1 h (P < 0.001), an effect reduced by preincubation with AS-602868 in a dose-dependent manner (at 1 µM P < 0.01, at 2.5–10 µM P < 0.001; n = 6; Fig. 6A). Similarly, TNF-{alpha} significantly induced NF-{kappa}B activation (P < 0.001, n = 6), which was inhibited by AS-602868 (Fig. 6B).


Figure 6
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6. Effect of IKK-2 inhibitor AS-602868 on IL-1beta (0.1 ng/ml)- and TNF-{alpha} (1 ng/ml)-induced NF-{kappa}B activation measured by TransAM assay. Data are expressed as % of the control response to either IL-1beta (A) or TNF-{alpha} (B) and are means ± SE of 6–8 donors. **P < 0.01, ***P < 0.001 compared with IL-1beta- or TNF-{alpha}-induced release at 100%.

 
As ERK, JNK, and NF-{kappa}B pathways are necessary for GRO-{alpha} expression and there is upstream NF-{kappa}B binding site on GRO-{alpha} promoter, we determined whether ERK and JNK activation were associated with NF-{kappa}B. The IL-1beta and TNF-{alpha} stimulation of p65 binding was not significantly altered by SP-600125 or PD-98059 (data not shown).

To determine further the interactions of NF-{kappa}B activation and the ERK and JNK pathways, we determined whether the I{kappa}B-{alpha} phosphorylated state induced by IL-1beta was affected by SP-600125 or PD-98059. We found no significant effect of SP-600125 (10 µM) or PD-98059 (25 µM) on I{kappa}B-{alpha} phosphorylation as measured by Western blotting. In addition, the IKK-2 inhibitor AS-602868 (1 µM), which significantly inhibits GRO-{alpha} expression, had no effect on either stress-activated protein kinase/JNK phosphorylation or p42/44 ERK phosphorylation induced by IL-1beta (data not shown).

Effect of AS-602868 on NF-{kappa}B p65 binding to GRO-{alpha} promoter. Serum-starved confluent human ASMC were subjected to ChIP with an anti-p65 antibody. Enrichment of specific DNA sequences in the chromatin immunoprecipitates indicates association of these ligand factors to DNA strands within intact chromatin. This was visualized by PCR amplification. Normalized samples with total input DNA control amplification (input DNA) showed a marked enrichment of the GRO-{alpha} promoter DNA after both IL-1beta (0.1 ng/ml; P < 0.001, n = 3) and TNF-{alpha} (1 ng/ml; P < 0.01, n = 3) at 2 h. This p65 immunoprecipitate enrichment of the GRO-{alpha} promoter was significantly reduced after AS-602868 (2.5 µm) for IL-1beta and for TNF-{alpha} (Fig. 7).


Figure 7
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 7. Chromatin immunoprecipitation (ChIP) assay to demonstrate the binding of p65 component of NF-{kappa}B to chromatin in response to IL-1beta and TNF-{alpha}. PCR analysis was performed on immunoprecipitation samples to amplify regions of GRO-{alpha} promoters around NF-{kappa}B sites. The PCR samples were normalized with each corresponding input. The immunoprecipitated (IP) DNA obtained at 2 h was increased after IL-1beta or TNF-{alpha}. AS-602868 (2.5 µM) inhibited IL-1beta- or TNF-{alpha}-induced p65 binding to the GRO-{alpha} promoter. Data are expressed relative to the untreated control medium only, which was given a value of 1 for each of 3 donors. **P < 0.01, ***P < 0.001 compared with control.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We found that ASMC express and release another important CXC chemokine, GRO-{alpha}, in response to cytokines IL-1beta and TNF-{alpha} but not in response to the Th-2 cytokines IL-4, IL-10, and IL-13. GRO-{alpha} released from ASMC stimulated by IL-1beta was active in causing neutrophil chemotaxis. The induction of GRO-{alpha} by IL-1beta and TNF-{alpha} involved the ERK and JNK pathways, with little contribution by the p38 MAPK pathway, in contrast to the induction of IL-8, which is dependent partly on ERK and p38 MAPK (13). The proinflammatory cytokines IL-1beta and TNF-{alpha} stimulated GRO-{alpha} expression and release from ASMC in a dose- and time-dependent manner, with IL-1beta being more potent than TNF-{alpha}. Although at the mRNA level the combined effect of IL-1beta and TNF-{alpha} appeared to be additive, the level of GRO-{alpha} released was greater than that compared with each cytokine alone, indicating some degree of synergy.

The Th-2 cytokines IL-4, IL-10, and IL-13 had no significant effect on GRO-{alpha} release and were also without effect on IL-1beta- or TNF-{alpha}-induced GRO-{alpha} release. The regulation of GRO-{alpha} appears to be different from that of another CXC chemokine, IL-8, known to be released from ASMC. For example, the Th-2 cytokines IL-4, IL-10, and IL-13, had an inhibitory effect on IL-8 and RANTES release stimulated by TNF-{alpha} and IFN-{gamma} in ASMC (17, 18), whereas IL-10 inhibited eotaxin release (7). On the other hand, IL-4 and IL-13 potentiated the stimulatory effect of IL-1beta or TNF-{alpha} on eotaxin release (15). Therefore, Th-2 cytokines may differ in their actions depending on the gene targeted in the same cell type. In addition, there are cell-specific differences because IL-4 and IL-13 can stimulate GRO-{alpha} mRNA expression in human nasal and human bronchial epithelial cells (21).

Our study of the involvement of MAPK pathways depends on the selectivity of the inhibitors used. The selectivity of SP-600125 as a JNK inhibitor (26), of SB-203580 as a p38 MAPK inhibitor (12), and of PD-98059 as an ERK inhibitor (9, 13) at the concentrations used has been previously shown for ASMC. Synthesis of the chemokines RANTES, eotaxin, and IL-8 in ASMC is dependent on ERK, JNK, and p38 MAPK pathways, but the release of GRO-{alpha} is dependent on ERK and JNK but not p38 pathways. Gene expression was only dependent on the ERK pathway, indicating that JNK activation may be important in regulating GRO-{alpha} release through posttranscriptional mechanisms. IL-1beta induction of eotaxin is inhibited by either MKK1 inhibitors or p38 MAPK inhibitors (15, 22), whereas RANTES synthesis induced by TNF-{alpha} is insensitive to inhibition of both ERK or p38 MAPK activation (1); in contrast, IL-1beta-induced RANTES release is sensitive to MKK1 inhibition but not to p38 MAPK inhibition (12). However, JNK activation is involved in both IL-1beta- and TNF-{alpha}-induced RANTES and IL-8 release, being more important in RANTES release (26). Therefore, the involvement of various MAPK pathways depends on the stimulus and the released chemokine.

The GRO-{alpha} promoter region contains a variety of DNA binding sites, including those for activator protein-1 and NF-{kappa}B (3). NF-{kappa}B activation represents a major pathway mediating GRO-{alpha} secretion in several cell types. Furthermore, both IL-1beta and TNF-{alpha} stimulate NF-{kappa}B activation in ASMC (2, 33). In our study, GRO-{alpha} expression was shown to be dependent on activation of NF-{kappa}B, because an inhibitor of IKK-2 inhibited both IL-1beta- and TNF-{alpha}-induced GRO-{alpha} mRNA expression and release. At the same time, the IKK-2 inhibitor also inhibited IL-1beta- and TNF-{alpha}-induced p65 activation. Similarly, the release of IL-8 and GM-CSF from ASMC exposed to IL-1beta or TNF-{alpha} was inhibited by another IKK-2 inhibitor (5). To further prove the involvement of NF-{kappa}B, we used the ChIP assay to show the in vivo p65 binding to GRO-{alpha} promoter induced by IL-1beta or TNF-{alpha}. The ChIP assay is a powerful technique to determine true in vivo binding of transcription factors and other nucleosomal proteins to chromatin in response to cytokines. We used this assay to determine the status of the NF-{kappa}B transcription complex at the promoters of key NF-{kappa}B-regulated genes in ASMC in response to IL-1beta or TNF-{alpha}. By using a specific antibody to the p65 subunit of NF-{kappa}B, we evaluated the recruitment of NF-{kappa}B p65 subunits. Gene promoter regions were amplified and analyzed by semiquantitative PCRs using specific primer pairs around NF-{kappa}B binding regions on the promoters of GRO-{alpha}. Enrichment of specific DNA sequences in chromatin immunoprecipitation indicated association of the antigen (p65) with specific NF-{kappa}B DNA binding sites within intact chromatin. This binding was significantly increased by the cytokines, an effect that was reduced in the presence of the IKK-2 inhibitor.

It has been reported that ERK or JNK activation can induce phosphorylation of both IKK-{alpha} and IKK-beta, leading to NF-{kappa}B activation (10, 14). In our study, cross talk between these pathways is also suggested by the more complete inhibition of GRO-{alpha} release with the IKK-2 inhibitor compared with the partial inhibition by the MAPK inhibitors. However, we found that NF-{kappa}B binding activity and I{kappa}B-{alpha} phosphorylation induced by IL-1beta were not significantly inhibited by the ERK inhibitor PD-98059 or the JNK inhibitor SP-600125, in agreement with a previous report (33). Furthermore, no inhibition of ERK or JNK phosphorylation was observed in the presence of the IKK-2 inhibitor AS-602868 at a concentration that caused significant inhibition of GRO-{alpha} release. We also showed that p65 binding induced by IL-1beta and TNF-{alpha} was not significantly altered by the MAPK inhibitors SP-600125 or PD-98059. These data indicate that ERK MAPK activation and NF-{kappa}B activation induced by IL-1beta independently regulated gene expression of GRO-{alpha} in ASMC. As discussed above, posttranscriptional mechanisms may be responsible for the inhibition of GRO-{alpha} release caused by SP-600125. Further investigations are required to definitely exclude any potential cross talk between these pathways.

The protein synthesis inhibitor cycloheximide alone and together with IL-1beta or TNF-{alpha} induced GRO-{alpha} mRNA expression, indicating that there are inhibitory proteins that control GRO-{alpha} expression; these could lead to increased mRNA stabilization as well as further activation of transcription factors such as NF-{kappa}B and c-Jun as shown in other cell types for cyclooxygenase-2 mRNA expression (24, 29). Cycloheximide inhibited GRO-{alpha} release induced by IL-1beta or TNF-{alpha}, suggesting that GRO-{alpha} release required de novo protein synthesis.

GRO-{alpha}, which is increased in the sputum of patients with chronic obstructive pulmonary disease (COPD) (32), has neutrophil and monocytic chemotactic and angiogenic activities and plays an important role during the inflammatory response (23). Therefore, ASMC may be an important source of GRO-{alpha} in the airways, particularly when exposed to proinflammatory cytokines such as IL-1beta and TNF-{alpha} that are overexpressed in airway diseases, including asthma and COPD (20, 31). The released GRO-{alpha} may contribute to neutrophil chemotaxis into the airways. Inhibition of GRO-{alpha} expression and release may be achieved through the suppression of NF-{kappa}B activation and, independently of NF-{kappa}B, by inhibition of ERK and JNK pathways.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by a grant from the Wellcome Trust (UK).


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. F. Chung, National Heart and Lung Institute, Imperial College, Dovehouse St., London SW3 6LY, UK (e-mail: f.chung{at}imperial.ac.uk)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Ammit AJ, Hoffman RK, Amrani Y, Lazaar AL, Hay DW, Torphy TJ, Penn RB, and Panettieri RA Jr. Tumor necrosis factor-{alpha}-induced secretion of RANTES and interleukin-6 from human airway smooth-muscle cells. Modulation by cyclic adenosine monophosphate. Am J Respir Cell Mol Biol 23: 794–802, 2000.[Abstract/Free Full Text]
  2. Amrani Y, Lazaar AL, and Panettieri RA Jr. Up-regulation of ICAM-1 by cytokines in human tracheal smooth muscle cells involves an NF-{kappa}B-dependent signaling pathway that is only partially sensitive to dexamethasone. J Immunol 163: 2128–2134, 1999.[Abstract/Free Full Text]
  3. Anisowicz A, Messineo M, Lee SW, and Sager R. An NF-{kappa}B-like transcription factor mediates IL-1/TNF-{alpha} induction of gro in human fibroblasts. J Immunol 147: 520–527, 1991.[Abstract]
  4. Bennett BL, Sasaki DT, Murray BW, O'Leary EC, Sakata ST, Xu W, Leisten JC, Motiwala A, Pierce S, Satoh Y, Bhagwat SS, Manning AM, and Anderson DW. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci USA 98: 13681–13686, 2001.[Abstract/Free Full Text]
  5. Birrell MA, Hardaker E, Wong S, McCluskie K, Catley M, De Alba J, Newton R, Haj-Yahia S, Pun KT, Watts CJ, Shaw RJ, Savage TJ, and Belvisi MG. I{kappa}-B kinase-2 inhibitor blocks inflammation in human airway smooth muscle and a rat model of asthma. Am J Respir Crit Care Med 172: 962–971, 2005.[Abstract/Free Full Text]
  6. Chung KF. Airway smooth muscle cells: contributing to and regulating airway mucosal inflammation? Eur Respir J 15: 961–968, 2000.[Abstract]
  7. Chung KF, Patel HJ, Fadlon EJ, Rousell J, Haddad EB, Jose PJ, Mitchell J, and Belvisi M. Induction of eotaxin expression and release from human airway smooth muscle cells by IL-1beta and TNF{alpha}: effects of IL-10 and corticosteroids. Br J Pharmacol 127: 1145–1150, 1999.[CrossRef][Web of Science]
  8. Dong C, Davis RJ, and Flavell RA. MAP kinases in the immune response. Annu Rev Immunol 20: 55–72, 2002.[CrossRef][Web of Science][Medline]
  9. Dudley DT, Pang L, Decker SJ, Bridges AJ, and Saltiel AR. A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci USA 92: 7686–7689, 1995.[Abstract/Free Full Text]
  10. Funakoshi M, Tago K, Sonoda Y, Tominaga S, and Kasahara T. A MEK inhibitor, PD98059 enhances IL-1-induced NF-{kappa}B activation by the enhanced and sustained degradation of I{kappa}B{alpha}. Biochem Biophys Res Commun 283: 248–254, 2001.[CrossRef][Web of Science][Medline]
  11. Grimshaw CE. Identification of a potent, orally active small molecule IKK-2 inhibitor. Inflamm Res 50: S149, 2001.[Medline]
  12. Hallsworth MP, Moir LM, Lai D, and Hirst SJ. Inhibitors of mitogen-activated protein kinases differentially regulate eosinophil-activating cytokine release from human airway smooth muscle. Am J Respir Crit Care Med 164: 688–697, 2001.[Abstract/Free Full Text]
  13. Hedges JC, Singer CA, and Gerthoffer WT. Mitogen-activated protein kinases regulate cytokine gene expression in human airway myocytes. Am J Respir Cell Mol Biol 23: 86–94, 2000.[Abstract/Free Full Text]
  14. Hirano M, Osada S, Aoki T, Hirai S, Hosaka M, Inoue J, and Ohno S. MEK kinase is involved in tumor necrosis factor {alpha}-induced NF-{kappa}B activation and degradation of I{kappa}B-{alpha}. J Biol Chem 271: 13234–13238, 1996.[Abstract/Free Full Text]
  15. Hirst SJ, Hallsworth MP, Peng Q, and Lee TH. Selective induction of eotaxin release by interleukin-13 or interleukin-4 in human airway smooth muscle cells is synergistic with interleukin-1beta and is mediated by the interleukin-4 receptor {alpha}-chain. Am J Respir Crit Care Med 165: 1161–1171, 2002.[Abstract/Free Full Text]
  16. Jarai G, Sukkar M, Garrett S, Duroudier N, Westwick J, Adcock I, and Chung KF. Effects of interleukin-1beta, interleukin-13 and transforming growth factor-beta on gene expression in human airway smooth muscle using gene microarrays. Eur J Pharmacol 497: 255–265, 2004.[CrossRef][Web of Science][Medline]
  17. John M, Au BT, Jose PJ, Lim S, Saunders M, Barnes PJ, Mitchell JA, Belvisi MG, and Chung KF. Expression and release of interleukin-8 by human airway smooth muscle cells: inhibition by Th-2 cytokines and corticosteroids. Am J Respir Cell Mol Biol 18: 84–90, 1998.[Abstract/Free Full Text]
  18. John M, Hirst SJ, Jose PJ, Robichaud A, Berkman N, Witt C, Twort CHC, Barnes PJ, and Chung KF. Human airway smooth muscle cells express and release RANTES in response to Th-1 cytokines: regulation by Th-2 cytokines and corticosteroids. J Immunol 158: 1841–1847, 1997.[Abstract]
  19. Johnson GL and Lapadat R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 298: 1911–1912, 2002.[Abstract/Free Full Text]
  20. Keatings VM, Collins PD, Scott DM, and Barnes PJ. Differences in interleukin-8 and tumor necrosis factor-{alpha} in induced sputum from patients with chronic obstructive pulmonary disease or asthma. Am J Resp Crit Care Med 153: 530–534, 1996.[Abstract]
  21. Meyer-Hoffert U, Lezcano-Meza D, Bartels J, Montes-Vizuet AR, Schroder JM, and Teran LM. Th2- and to a lesser extent Th1-type cytokines upregulate the production of both CXC (IL-8 and gro-{alpha}) and CC (RANTES, eotaxin, eotaxin-2, MCP-3 and MCP-4) chemokines in human airway epithelial cells. Int Arch Allergy Immunol 131: 264–271, 2003.[CrossRef][Web of Science][Medline]
  22. Moore PE, Church TL, Chism DD, Panettieri RA Jr, and Shore SA. IL-13 and IL-4 cause eotaxin release in human airway smooth muscle cells: a role for ERK. Am J Physiol Lung Cell Mol Physiol 282: L847–L853, 2002.[Abstract/Free Full Text]
  23. Moser B, Clark-Lewis I, Zwahlen R, and Baggiolini M. Neutrophil-activating properties of the melanoma growth-stimulatory activity. J Exp Med 171: 1797–1802, 1990.[Abstract/Free Full Text]
  24. Newton R, Stevens DA, Hart LA, Lindsay M, Adcock IM, and Barnes PJ. Superinduction of COX-2 mRNA by cycloheximide and interleukin-1beta involves increased transcription and correlates with increased NF-{kappa}B and JNK activation. FEBS Lett 418: 135–138, 1997.[CrossRef][Web of Science][Medline]
  25. Nie M, Corbett L, Knox AJ, and Pang L. Differential regulation of chemokine expression by peroxisome proliferator-activated receptor {gamma} agonists: interactions with glucocorticoids and beta2-agonists. J Biol Chem 280: 2550–2561, 2005.[Abstract/Free Full Text]
  26. Oltmanns U, Issa R, Sukkar MB, John M, and Chung KF. Role of c-jun N-terminal kinase in the induced release of GM-CSF, RANTES and IL-8 from human airway smooth muscle cells. Br J Pharmacol 139: 1228–1234, 2003.[CrossRef][Web of Science]
  27. Pinkenburg O, Platz J, Beisswenger C, Vogelmeier C, and Bals R. Inhibition of NF-{kappa}B mediated inflammation by siRNA expressed by recombinant adeno-associated virus. J Virol Methods 120: 119–122, 2004.[CrossRef][Web of Science][Medline]
  28. Richmond A, Balentien E, Thomas HG, Flaggs G, Barton DE, Spiess J, Francke U, and Derynck R. Molecular characterization and chromosomal mapping of melanoma growth stimulatory activity, a growth factor structurally related to beta-thromboglobulin. EMBO J 7: 2025–2033, 1988.[Web of Science][Medline]
  29. Ristimaki A, Garfinkel S, Wessendorf J, Maciag T, and Hla T. Induction of cyclooxygenase-2 by interleukin-1{alpha}. Evidence for post-transcriptional regulation. J Biol Chem 269: 11769–11775, 1994.[Abstract/Free Full Text]
  30. Saunders MA, Mitchell JA, Seldon PM, Yacoub MH, Barnes PJ, Giembycz MA, and Belvisi MG. Release of granulocyte-macrophage colony stimulating factor by human cultured airway smooth muscle cells: suppression by dexamethasone. Br J Pharmacol 120: 545–546, 1997.[CrossRef][Web of Science]
  31. Sousa AR, Trigg CJ, Lane SJ, Hawksworth R, Nakhosteen JA, Poston RN, and Lee TH. Effect of inhaled glucocorticoids on IL-1beta and IL-1 receptor antagonist (IL-1 ra) expression in asthmatic bronchial epithelium. Thorax 52: 407–410, 1997.[Abstract]
  32. Traves SL, Culpitt SV, Russell RE, Barnes PJ, and Donnelly LE. Increased levels of the chemokines GRO{alpha} and MCP-1 in sputum samples from patients with COPD. Thorax 57: 590–595, 2002.[Abstract/Free Full Text]
  33. Wang CC, Lin WN, Lee CW, Lin CC, Luo SF, Wang JS, and Yang CM. Involvement of p42/p44 MAPK, p38 MAPK, JNK, and NF-{kappa}B in IL-1beta-induced VCAM-1 expression in human tracheal smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 288: L227–L237, 2005.[Abstract/Free Full Text]
  34. Xie S, Sukkar MB, Issa R, Oltmanns U, Nicholson AG, and Chung KF. Regulation of TGF-beta1-induced connective tissue growth factor expression in airway smooth muscle cells. Am J Physiol Lung Cell Mol Physiol 288: L68–L76, 2005.[Abstract/Free Full Text]
  35. Zhu Z, Tang W, Ray A, Wu Y, Einarsson O, Landry ML, Gwaltney J Jr, and Elias JA. Rhinovirus stimulation of interleukin-6 in vivo and in vitro. Evidence for nuclear factor {kappa}B-dependent transcriptional activation. J Clin Invest 97: 421–430, 1996.[Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
W. Hu, F. Li, S. Mahavadi, and K. S. Murthy
Upregulation of RGS4 expression by IL-1{beta} in colonic smooth muscle is enhanced by ERK1/2 and p38 MAPK and inhibited by the PI3K/Akt/GSK3{beta} pathway
Am J Physiol Cell Physiol, June 1, 2009; 296(6): C1310 - C1320.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
I. Kogan-Sakin, M. Cohen, N. Paland, S. Madar, H. Solomon, A. Molchadsky, R. Brosh, Y. Buganim, N. Goldfinger, H. Klocker, et al.
Prostate stromal cells produce CXCL-1, CXCL-2, CXCL-3 and IL-8 in response to epithelia-secreted IL-1
Carcinogenesis, April 1, 2009; 30(4): 698 - 705.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
T. Quante, Y. C. Ng, E. E. Ramsay, S. Henness, J. C. Allen, J. Parmentier, Q. Ge, and A. J. Ammit
Corticosteroids Reduce IL-6 in ASM Cells via Up-Regulation of MKP-1
Am. J. Respir. Cell Mol. Biol., August 1, 2008; 39(2): 208 - 217.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. N. Kang, J. A. Jude, R. A. Panettieri Jr., T. F. Walseth, and M. S. Kannan
Glucocorticoid regulation of CD38 expression in human airway smooth muscle cells: role of dual specificity phosphatase 1
Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L186 - L193.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
K. G. Tirumurugaan, J. A. Jude, B. N. Kang, R. A. Panettieri, T. F. Walseth, and M. S. Kannan
TNF-{alpha} induced CD38 expression in human airway smooth muscle cells: role of MAP kinases and transcription factors NF-{kappa}B and AP-1
Am J Physiol Lung Cell Mol Physiol, June 1, 2007; 292(6): L1385 - L1395.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/1/L66    most recent
00384.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Issa, R.
Right arrow Articles by Chung, K. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Issa, R.
Right arrow Articles by Chung, K. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.