Am J Physiol Lung Cell Mol Physiol 291: L966-L975, 2006.
First published June 16, 2006; doi:10.1152/ajplung.00045.2006
1040-0605/06 $8.00
Mitochondrial aldehyde dehydrogenase attenuates hyperoxia-induced cell death through activation of ERK/MAPK and PI3K-Akt pathways in lung epithelial cells
Dong Xu,1
Jill R. Guthrie,2
Sherry Mabry,1
Thomas M. Sack,2 and
William E. Truog1
1Neonatology Section, Department of Pediatrics, School of Medicine, University of Missouri-Kansas City, Children's Mercy Hospital, Kansas City; and 2Midwest Research Institute, Kansas City, Missouri
Submitted 6 February 2006
; accepted in final form 9 June 2006
 |
ABSTRACT
|
|---|
Oxygen toxicity is one of the major risk factors in the development of the chronic lung disease or bronchopulmonary dysplasia in premature infants. Using proteomic analysis, we discovered that mitochondrial aldehyde dehydrogenase (mtALDH or ALDH2) was downregulated in neonatal rat lung after hyperoxic exposure. To study the role of mtALDH in hyperoxic lung injury, we overexpressed mtALDH in human lung epithelial cells (A549) and found that mtALDH significantly reduced hyperoxia-induced cell death. Compared with control cells (Neo-A549), the necrotic cell death in mtALDH-overexpressing cells (mtALDH-A549) decreased from 25.3 to 6.5%, 50.5 to 9.1%, and 52.4 to 15.1% after 24-, 48-, and 72-h hyperoxic exposure, respectively. The levels of intracellular and mitochondria-derived reactive oxygen species (ROS) in mtALDH-A549 cells after hyperoxic exposure were significantly lowered compared with Neo-A549 cells. mtALDH overexpression significantly stimulated extracellular signal-regulated kinase (ERK) phosphorylation under normoxic and hyperoxic conditions. Inhibition of ERK phosphorylation partially eliminated the protective effect of mtALDH in hyperoxia-induced cell death, suggesting ERK activation by mtALDH conferred cellular resistance to hyperoxia. mtALDH overexpression augmented Akt phosphorylation and maintained the total Akt level in mtALDH-A549 cells under normoxic and hyperoxic conditions. Inhibition of phosphatidylinositol 3-kinase (PI3K) activation by LY294002 in mtALDH-A549 cells significantly increased necrotic cell death after hyperoxic exposure, indicating that PI3K-Akt activation by mtALDH played an important role in cell survival after hyperoxia. Taken together, these data demonstrate that mtALDH overexpression attenuates hyperoxia-induced cell death in lung epithelial cells through reduction of ROS, activation of ERK/MAPK, and PI3K-Akt cell survival signaling pathways.
extracellular signal-regulated kinase; mitogen-activated protein kinase; phosphatidylinositol 3-kinase-Akt
PATIENTS, INCLUDING PREMATURE NEWBORNS with respiratory distress, are frequently treated with supplemental oxygen. After the oxygen therapy, some patients may develop acute and chronic lung injury because of oxygen toxicity. Hyperoxic lung injury is characterized by pulmonary inflammation, hemorrhage, and eventually cell death of pulmonary capillary endothelial cells and alveolar epithelial cells, which results in impaired gas exchange and pulmonary edema (5, 8). Currently, there are no safe and known effective adjunctive treatments to be administered with supplemental oxygen to ameliorate or prevent oxygen-induced epithelial cell injury.
Reactive oxygen species (ROS) generated during supplemental oxygen therapy are extremely cytotoxic, and they have the ability to interact with and alter essential cell components, including proteins, lipids, carbohydrates, and DNA (15, 36). Decreased antioxidant capacity of lung tissue during hyperoxia may contribute to the lung injury (14, 37). Thus the elimination of excess ROS generation, either by blocking ROS formation or increasing antioxidant production, should result in reduced cellular oxidative injury with ultimate protection of cells from hyperoxia-induced cell death (3, 11).
Hyperoxia induces both apoptotic (6, 12) and nonapoptotic cell death in pulmonary epithelial cells (13, 26). Cell death is thought to be the major contributing factor in the development of acute or chronic lung injury after oxygen therapy. Apoptosis is a tightly regulated process. Hyperoxia induces apoptotic cell death in lung epithelial cells by activation of both intrinsic and extrinsic apoptosis pathways (23, 32). Nonapoptotic cell death, including necrosis and oncosis, is characterized by cell and organelle swelling, vacuolization, and increased membrane permeability (18, 21, 40). Hyperoxia primarily induces necrotic cell death in cultured A549 cells, a pulmonary type II epithelial cell line derived from human lung adenocarcinoma. A small portion of cell death is due to apoptosis in cultured A549 cells after hyperoxia. Two cell survival signaling pathways, extracellular signal-regulated kinase/mitogen-activated protein kinase (ERK/MAPK) and phosphatidylinositol 3-kinase-Akt (PI3K-Akt), are implicated in the survival of pulmonary epithelial cells after hyperoxic exposure. Hyperoxia activates the ERK/MAPK pathway and suppresses the PI3K-Akt pathway in lung epithelial cells (7, 10, 20, 35, 39). Increased ERK activation or constitutive expression of the active form of Akt delays hyperoxia-induced cell death and increases animal survival after prolonged hyperoxic exposure (7, 20).
Mitochondria are the major source of ROS production under normoxic or hyperoxic conditions (4). Mitochondrial aldehyde dehydrogenase (mtALDH or ALDH2) is a nuclear-encoded mitochondrial enzyme that is localized in mitochondrial matrix (25). The role of mtALDH in lung epithelial cells during oxidative stress or hyperoxia is not known. In this study, we found that mtALDH was downregulated in the neonatal rat lung after hyperoxic exposure, using proteomic analysis. mtALDH overexpression in lung epithelial cells activated both ERK/MAPK and PI3K-Akt signaling pathways and protected lung epithelial cells from hyperoxia-induced cell death.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Oxygen exposures.
Animal use was approved by the Institutional Animal Care and Use Committee of the University of Missouri-Kansas City. Newborn rats at 4 days of age were randomly divided into two groups, room air (normoxia) and oxygen (hyperoxia) exposure groups, according to our previously published procedure (34). The animals were housed in regular rat cages placed into Lucite chambers. The newborn rats in the chambers breathed either room air or humidified 95% oxygen. Oxygen concentration was monitored continuously with an oxygen analyzer. Dams were given food and water ad libitum, kept on a 12:12-h on-off light cycle, and fostered by rotating in and out of the chamber every 24 h to avoid oxygen toxicity. At the designated exposure time points, the animals from both treatment groups were killed by exsanguination after receiving intraperitoneal pentobarbital for anesthesia. Lung tissues from each group were collected, minced, and stored in liquid nitrogen for protein extraction.
Two-dimensional gel electrophoresis and protein identification.
Protein was extracted from neonatal rat lungs treated with room air or 95% oxygen. Equal amounts (200 µg) of proteins were resuspended in 200 µl of rehydration buffer containing 8 M urea, 2% CHAPS, 0.5% IPG buffer, and 0.002% bromophenol blue for isoelectric focusing electrophoresis (IEF). IEF was carried out with the IPGphor system from Amersham Bioscience (Piscataway, NJ). Immobiline gel strips (11 cm, pH 37; Amersham Bioscience) were rehydrated with resuspended samples in rehydration buffer at 30 V, 20°C, for 12 h (rehydration loading). The gels were run according to the following protocol: 200 V, 1 h; 500 V, 1 h; 1,000 V, 1 h; 3,000 V, 1 h; gradient from 3,000 to 8,000 V for 3 h; and 8,000 V, 3 h. After IEF, Immobiline gel strips were equilibrated in buffer containing 50 mM Tris·HCl (pH 6.8), 30% glycerol, 6 M urea, 2% SDS, and 1% DTT for 15 min at room temperature before being loaded onto SDS-PAGE (816%) and sealed with 0.5% agarose gel in 1x Tris-glycine-SDS running buffer with 0.002% bromophenol blue. The electrophoresis was run at 50 mA per gel for approximately 2 h. Gels were stained with Bio-Safe Coomassie Satin kit from Bio-Rad Laboratory (Hercules, CA) according to the manufacturer's protocol. Protein spots on the gels were excised manually in ultra-clean conditions to minimize contamination during gel handling. The gel pieces were destained, and residual SDS was removed using a solution of acetonitrile and 25 mM ammonium bicarbonate. The gel pieces were then dehydrated with acetonitrile and dried in a vacuum centrifuge. They were hydrated with sequencing-grade modified trypsin and incubated overnight at 37°C. The resulting peptides were extracted out of the gel pieces using a solution of 50% acetonitrile and 5% trifluor-acetic acid (TFA). Matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) analysis was performed on an Applied Biosystems Voyager DE-STR mass spectrometer. Samples were spotted onto MALDI plates using an Applied Biosystems SymBiot Sample Workstation. Protein database search was performed using the accurate molecular weight data provided in the peptide mass map. Peptide masses obtained by MALDI-TOF were entered into Swiss-Prot and NCBInr protein databases. Protein Prospector program was used to search for protein candidates.
Plasmid construction and transfection.
For human mtALDH plasmid construction, full-length human mtALDH cDNA without stop codon was amplified from human lung cDNA library (Clontech, Mountain View, CA) by RT-PCR using the following primers: sense, ATGTTGCGCGCTGCCGCCCGCTTC; antisense, TGAGTTCTTCTGAGGCACGAC. The resulting human mtALDH cDNA was subcloned into plasmid vector pcDNA3.1 (Invitrogen, Carlsbad, CA). The mtALDH sequence was confirmed by direct nucleotide sequencing. mtALDH-pcDNA3 and empty pcDNA3.1 plasmids were transfected into A549 cells using LipofectAMINE (Invitrogen). The transfected cells were then selected by G418 sulfate at 500 µg/ml for 10 days. Single clone was selected by limited dilution, and mtALDH protein expression was confirmed by Western blotting with anti-V5 antibody (Invitrogen).
Cell culture and cell treatment.
A549 cells were purchased from American Type Culture Collection (Manassas, VA) and grown in DMEM containing 10% fetal bovine serum, 50 µg/ml penicillin, and 50 µg/ml streptomycin in 5% CO2 at 37°C. Normoxic exposure of the cells was conducted under room air and 5% CO2 in a humidified cell culture incubator at 37°C. Hyperoxic exposure of the cells was conducted in a humidified chamber (Billups and Rothenberg, Del Mar, CA), and the chamber was flushed with 95% O2-5% CO2 (hyperoxia) at a flow rate of 10 l/min for 15 min before incubation at 37°C. In U0126 and LY294002 pretreatment experiments, cells were treated with or without 10 µM U0216 or LY294002 for 30 min before normoxic or hyperoxic exposure.
Immunofluorescent staining.
Cells were cultured on coverslips and fixed with 1% fresh paraformaldehyde in PBS for 15 min. The fixed cells were washed with PBS and permeabilized in 0.2% Triton X-100 in PBS for 5 min. The permeabilized cells were blocked with 1% BSA in PBS for 30 min and stained with anti-V5-FITC antibody (Invitrogen) for 1 h. After the staining, the coverslips were washed, mounted in mounting medium, and viewed under florescent microscope.
Western blotting analysis.
Antibodies were purchased from Cell Signaling Technology (Beverly, MA), and they were used according to the manufacturer's instructions. Cultured cells after treatment were washed with cold PBS three times, and then 300 µl of sample lysis buffer [62.5 mM Tris·HCl, pH 6.8, 2% (wt/vol) SDS, 10% glycerol, 200 mM DTT, and protease cocktails] were added to each plate. Cell lysates were centrifuged at 12,000 g for 10 min. The supernatants were saved for analysis. Protein concentration was determined by bicinchoninic acid (BCA) protein assay kit (Sigma, St. Louis, MO). Samples containing 50 µg of protein in loading sample buffer were boiled for 5 min and loaded on 12% Tris-glycine SDS-PAGE gels. Gels were run at 120 V for
2 h and transferred overnight at 20 V to nitrocellulose membranes. Membranes were incubated with the blocking buffer containing 5% nonfat milk in PBST (0.1% Tween-20 in PBS) for 1 h, washed with PBST, and incubated overnight with the primary antibody against either phosphorylated ERK or phosphorylated Akt (Ser-473). The membranes were washed in PBST, and proteins were visualized using horseradish peroxidase (HRP)-conjugated anti-rabbit IgG and enhanced chemiluminescence (Amersham Bioscience). The membranes were stripped using a standard stripping solution (62.5 mM Tris·HCl, pH 6.8, 2% SDS, and 100 mM
-mercaptoethanol) at 50°C and reprobed with nonphosphorylated ERK, nonphosphorylated Akt and
-actin antibodies. Phosphorylated ERK and phosphorylated Akt protein band intensities on autoradiogram were analyzed with Image-Quant (Molecular Dynamics, Sunnyvale, CA) and normalized by nonphosphorylated ERK, nonphosphorylated Akt or
-actin in the same sample, respectively.
mtALDH activity assay.
mtALDH activity was measured as described previously (9). Neo-A549 and mtALDH-overexpressing (mtALDH-A549) cells cultured on plates were collected in a buffer of 50 mM Tris·HCl, pH 8.5. Resuspended cells were sonicated at setting 4 for 5 s by VirSonic sonicator from VirTis (Gardiner, NY). The cell homogenates were centrifuged at 12,000 g for 10 min. The supernatants were saved, and protein concentration was determined. Mitochondria were isolated from cultured cells using an mitochondria isolation kit from Pierce (Rockford, IL). The enzyme activity assay was carried out in 100 µl of 50 mM Tris·HCl, pH 8.5, containing 50 µg of prepared protein, 15 µM propionaldehyde, 1 mM NAD, and 1 mM 4-methylpyrazole. ALDH activity was determined by spectrometer for NADH formation at 340 nm.
Analysis of necrotic cell death (cell viability measurement and cytotoxicity assay).
After exposure to normoxic or hyperoxic conditions, nonadherent and trypsinized adherent cells were collected by centrifugation. Both nonadherent and adherent cells were subsequently subjected to staining with Trypan blue exclusion (0.2%) for viability within 5 min. Cell suspension from each sample was prepared using a 0.4% Trypan blue solution in 1:1 dilution. Cells were then loaded onto the counting chambers of a hemocytometer. The number of stained cells and total number of cells were counted at least twice. Cell death was determined by the percentage of stained cells to total cells. Lactate dehydrogenase (LDH) assay kit was from Biovision (Mountain View, CA), and LDH activity was measured per the manufacturer's instruction. Briefly, cells were incubated in an incubator (5% CO2, 37°C) for the appropriate time of treatment. The cultured media were collected and saved. Adherent cells were washed with PBS and lysed with 1% Triton in 50 mM Tris·HCl, pH 7.5. Both cell cultured media and cell lysates (100 µl/well) were carefully transferred into the corresponding wells of a 96-well plate. Reaction mixture (100 µl) was then added to each well and incubated for 30 min at room temperature. The absorbance of all samples at 490 nm was measured using a microplate reader. The cytotoxicity was determined by the percentage of LDH activity in cultured medium over combined LDH activities of the cultured medium and cell lysate.
Analysis of apoptotic cells.
Apoptosis detection kit was from R&D Systems (Minneapolis, MN). Treated cells were trypsinized and collected by centrifugation at 500 g for 5 min. Cells were washed with cold PBS once and resuspended in 100 µl of binding buffer containing 10 mM HEPES, pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, and 1.8 mM CaCl2. Cells were stained with Annexin V-FITC (0.025 µg/sample) for 15 min according to the manufacturer's instruction. The stained cells were subjected to flow cytometry analysis.
Assessment of intracellular and mitochondrial ROS levels.
After normoxic or hyperoxic treatment, cultured cells were stained with 10 µM 2',7'-dichlorodihydrofluorescein diacetate, succinimidyl ester (OxyBURST Green H2DCFDA, SE; Molecular Probes), for 10 min. The stained cells were washed three times with PBS and then trypsinized with 0.025% trypsin-0.05% EDTA. The resuspended cells were subjected to fluorescent intensity measurement by flow cytometry. For mitochondria-derived ROS measurement, cells were incubated with 10 µM dihydrorhodamine-123 (Molecular Probes) for 15 min. The stained cells were washed three times with PBS and then trypsinized with 0.025% trypsin-0.05% EDTA. The resuspended cells were subjected to rhodamine-123 fluorescent intensity measurement by flow cytometry.
Statistical analysis.
The results are expressed as means ± SE of data obtained from two or more experiments or, where appropriate, as means ± SD. Statistical analysis was performed using Student's t-test for paired comparisons and ANOVA for multiple comparisons. A value of P < 0.05 was considered significant.
 |
RESULTS
|
|---|
The protein extracts from neonatal rat lung tissue after normoxic or hyperoxic exposure were analyzed by two-dimensional gel electrophoresis (2-DE). Many protein spots were displayed on the gels from isoelectric point (pI) 3 to 7 (data not shown). Six unknown protein spots, one gel blank spot, and one positive control spot (serum albumin) were excised from the Coomassie blue-stained gels for protein identification. One of the unknown and downregulated protein spots (Fig. 1, A and B, circled) was identified as a nuclear-encoding mtALDH. mtALDH appeared as a discrete spot (pI = 6.0, mol wt = 56.0 kDa) on the gels of the normoxic group, and the same protein was not visible on the gels of the hyperoxic group (Fig. 1B). mtALDH activities were measured in isolated mitochondria from cultured A549 lung type II epithelial cells treated with normoxia or hyperoxia for 3 days. The mtALDH activity in hyperoxia-treated A549 cells was decreased by
40% compared with normoxia-treated A549 cells (n = 3; Fig. 1C).

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 1. Mitochondrial aldehyde dehydrogenase (mtALDH) expression and activity under conditions of normoxia and hyperoxia. A and B: two-dimensional gel electrophresis (2-DE) analysis of mtALDH expression under conditions of normoxia and hyperoxia. Protein extracts from neonatal rat lungs treated with normoxia (room air; A) or hyperoxia (95% O2; B) for 10 days were analyzed by 2-DE analysis. The gels were stained with Coomassie blue. mtALDH protein spots were marked with circles. C: mtALDH activities in A549 cells under normoxic or hyperoxic conditions for 3 days (n = 3, data are expressed as means ± SD). Isolated mitochondrial protein from attached cells was used for the mtALDH activity assay.
|
|
To characterize the role of mtALDH in hyperoxic lung injury and cell death, we generated a stable cell line (mtALDH-A549) overexpressing human mtALDH-V5 fusion protein by transfecting pcDNA3-V5-human mtALDH plasmid into A549 lung type II epithelial cells. mtALDH overexpression was detected with an anti-V5 antibody by Western blotting in mtALDH-A549 cells, but not in control Neo-A549 cells, as shown in Fig. 2A. Immunofluorescent study of mtALDH-A549 cells with an anti-V5 antibody revealed a punctuate appearance in cytoplasm, which is consistent with mitochondrial distribution. No specific immunofluorescent staining was observed in the cytoplasm of Neo-A549 cells (Fig. 2B). Total mtALDH activities were also assayed in Neo-A549 and mtALDH-A549 cells (Fig. 2C). The total activity increased more than twofold in mtALDH-A549 cells compared with Neo-A549 cells (P < 0.01, n = 6; Fig. 2D).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2. mtALDH overexpression in human lung epithelial cells (A549). A: overexpressed human mtALDH was measured by Western blotting analysis in Neo-A549 and mtALDH-A549 cells using a monoclonal antibody against V5 tag. B: overexpressed human mtALDH was localized in the mitochondria. Immunofluorescent staining was performed using a V5-FITC antibody. C: a representative mtALDH activity assay was performed in a linear range. OD, optical density. D: total mtALDH activities were measured in Neo-A549 and mtALDH-A549 cell lines. *P < 0.001, n = 6, vs. Neo-A549 cell line.
|
|
Apoptotic and necrotic cell death during hyperoxia is thought to be responsible for acute and chronic lung injury. We exposed cultured Neo-A549 and mtALDH-A549 cells under conditions of normoxia and hyperoxia and measured necrotic cell death by Trypan blue exclusion and cytotoxicity assays. After normoxic exposure for up to 72 h, necrotic cell death between Neo-A549 and mtALDH-A549 cells was similar and ranged from 2.8 to 4.5% in Trypan blue exclusion assay (Fig. 3A) and from 0 to 1.7% in LDH cytotoxicity assay (Fig. 3B). Hyperoxia caused significantly necrotic cell death in Neo-A549 cells. The dead cells could be found in both nonadherent and adherent cells in Trypan blue exclusion assay. Compared with cells under normoxic condition, the percentage of necrotic cell death under hyperoxic condition increased to 25.3% from 4.5% (24 h), to 50.5% from 3.7% (48 h), and to 52.4% from 4.5% (72 h) (P < 0.001, n = 6; Fig. 3A). In cytotoxicity assay, the percentage of cytotoxicity in Neo-A549 cells increased to 4.6% from 0%, to 10.3% from 0%, and to 24.8% from 1.7% after 24-, 48-, and 72-h hyperoxic exposure, respectively, compared with the cells exposed to normoxia (P < 0.001, n = 6; Fig. 3B). The apoptotic cell death after 48-h normoxic or hyperoxic exposure was analyzed by Annexin V staining and flow cytometry (Fig. 3C). The percentage of Annexin V-positive cells was significantly higher in hyperoxia-treated Neo-A549 cells (0.84%) than in normoxia-treated Neo-A549 cells (0.41%; P < 0.01, n = 6).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 3. The cytoprotective effect of mtALDH on hyperoxia-induced cell death. A: necrotic cell death was determined by Trypan blue exclusion assay in both nonadherent and adherent cells. *P < 0.001, n = 6, vs. Neo-A549 cells under normoxic condition. #P < 0.001, n = 6, vs. Neo-A549 cells under hyperoxic condition. B: cytotoxicity assay by lactate dehydrogenase (LDH) release measurement. Cytotoxicity is presented as the percentage of LDH activity in cultured medium relative to combined LDH activities from both cultured medium and cell lysate. *P < 0.001, n = 6, vs. Neo-A549 cells under normoxic condition. #P < 0.001, n = 6, vs. Neo-A549 cells under hyperoxic condition. C: apoptotic cell death was determined by Annexin V-FITC staining and flow cytometry analysis after 48-h normoxic or hyperoxic exposure. *P < 0.01, n = 6, vs. Neo-A549 cells under normoxic condition. #P < 0.01, n = 6, vs. Neo-A549 cells under hyperoxic condition.
|
|
When mtALDH-A549 cells were treated with the same hyperoxic condition, the percentage of hyperoxia-induced necrotic cell death in mtALDH-A549 cells was significantly lowered compared with Neo-A549 cells in Trypan blue exclusion assay (Fig. 3A). The necrotic cell death decreased to 6.5% in mtALDH-A549 cells from 25.3% in Neo-A549 cells (P < 0.001, n = 6), to 9.1% from 50.5% (P < 0.001, n = 6), and to 15.1% from 52.4% (P < 0.001, n = 6) after 24-, 48-, and 72-h hyperoxic exposure, respectively. The percentage of necrotic cell death in cytotoxicity assay after hyperoxic exposure in mtALDH-A549 was also significantly decreased compared with Neo-A549 cells (Fig. 3B). The necrotic cell death was decreased to 0% in mtALDH-A549 cells from 4.7% in Neo-A549 cells after 24 h (P < 0.001, n = 6), to 1.7% from 10.3% after 48 h (P < 0.001, n = 6), and to 7.6% from 24.8% after 72 h (P < 0.001, n = 6). The percentage of apoptotic cell death assayed by Annexin V staining significantly fell to 0.48% in mtALDH-A549 cells from 0.84% in Neo-A549 cells after 48-h hyperoxic treatment (P < 0.001, n = 6; Fig. 3C). We did not observe alterations of DNA fragmentation, cytochrome c release, or caspase-3 and -9 activation after normoxic or hyperoxic treatment in cultured Neo-A549 or mtALDH-A549 cells (data not shown).
Intracellular ROS levels were measured by flow cytometry after the cultured cells were stained with H2DCFDA (Fig. 4A). The intracellular ROS levels were similar in Neo-A549 and mtALDH-A549 cells under normoxic condition. After 24-h hyperoxic exposure, the intracellular ROS level in Neo-A549 cells increased approximately threefold compared with the cells exposed to normoxia (P < 0.001, n = 6). However, the intracellular ROS level in mtALDH-A549 increased only approximately twofold compared with Neo-A549 cells after 24-h hyperoxia treatment. The intracellular ROS level in mtALDH-A549 cells was significantly decreased compared with Neo-A549 cells (P < 0.001, n = 6). Mitochondria-derived ROS level was measured by flow cytometry after the cells were stained with dihydrorhodamine-123 (Fig. 4B). The mitochondrial ROS levels in Neo-A549 and mtALDH-A549 cells were similar under the normoxic condition. The mitochondrial ROS level in Neo-A549 cells after 24-h hyperoxic exposure increased approximately twofold compared with the cells exposed to normoxia (P < 0.001, n = 6). The mitochondrial ROS level in mtALDH-A549 cells also was elevated compared with cells under the hyperoxic condition, but its level was significantly decreased compared with Neo-A549 cells (P < 0.001, n = 6).

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 4. mtALDH overexpression lowers intracellular and mitochondria-derived reactive oxygen species (ROS) production induced by hyperoxia. A: intracellular ROS levels were measured by flow cytometry using 2',7'-dichlorodihydrofluorescein diacetate, succinimidyl ester (OxyBURST Green H2DCFDA, SE), after Neo-A549 and mtALDH-A549 cells were exposed to normoxia (room air and 5% CO2) or hyperoxia (95% O2 and 5% CO2) for 24 h. B: mitochondria-derived ROS levels were measured by flow cytometry using dihydrorhodamine-123 (DHR 123) after Neo-A549 and mtALDH-A549 cells were exposed to normoxia (room air and 5% CO2) or hyperoxia (95% O2 and %5 CO2) for 24 h.
|
|
Western blotting analysis showed that both mtALDH and hyperoxia stimulated ERK phosphorylation. ERK activation was detected in mtALDH-A549 cells after 0-, 24-, 48-, and 72-h hyperoxic exposure and in Neo-A549 cells after 48- and 72-h hyperoxic exposure (Fig. 5A). Under the 48-h normoxic condition, phosphorylated ERK in Neo-A549 cells was expressed at a very low level. However, mtALDH stimulated ERK phosphorylation in mtALDH-A549 cells under the same normoxic condition. A sevenfold increase in mtALDH-A549 cells was detected compared with Neo-A549 cells (Fig. 5, B and C). Hyperoxia also stimulated ERK phosphorylation in Neo-A549 cells. A sixfold increase was observed after 48-h hyperoxic exposure. The ERK phosphorylation after 48-h hyperoxic exposure in mtALDH-A549 cells was maintained at a high level, similar to the level before hyperoxic exposure (Fig. 5, B and C).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5. mtALDH overexpression stimulates ERK activation. A: representative Western blotting analysis of ERK phosphorylation in Neo-A549 and mtALDH-A549 cells under hyperoxic condition for up to 72 h. p-ERK, phosphorylated ERK; hyperoxia, 95% O2 and 5% CO2. B: representative Western blotting analysis of ERK phosphorylation in Neo-A549 and mtALDH-A549 cells after 48-h normoxic or hyperoxic exposure. N, normoxia (room air and 5% CO2); H, hyperoxia (95% O2 and 5% CO2). C: levels of phosphorylated ERK in B were quantified by densitometry and normalized by total ERK. Data are expressed as means ± SD.
|
|
Next, we pretreated Neo-A549 and mtALDH-A549 cells with or without 10 µM U0126, an upstream kinase (MEK1/2) inhibitor, and measured the necrotic cell death by Trypan blue exclusion and cytotoxicity assays after 48-h normoxic or hyperoxic exposure. The U0126 pretreatment increased the necrotic cell death in Neo-A549 and mtALDH-A549 cells after 48-h normoxic or hyperoxic treatments. The necrotic cell death measured by Trypan blue exclusion assay in Neo-A549 cells after U0126 pretreatment significantly increased to 12.6% from 4.6% under the normoxic condition (P < 0.001, n = 6; Fig. 6A) and to 44.5% from 34.7% under the hyperoxic condition (P < 0.001, n = 6; Fig. 6A). In LDH cytotoxicity assay, the necrotic cell death in Neo-A549 cells after U0126 pretreatment increased to 14.1% from 11.2% under the hyperoxic condition (P < 0.05, n = 6; Fig. 6B). The necrotic cell death measured by Trypan blue exclusion assay in mtALDH-A549 cells after U0126 pretreatment increased to 11.6% from 4.7% under the normoxic condition (P < 0.001, n = 6; Fig. 6A) and to 26.0% from 9.3% under the hyperoxic condition (P < 0.001, n = 6; Fig. 6A). In LDH cytotoxicity assay, the necrotic cell death in mtALDH-A549 cells after U0126 pretreatment increased to 9.4% from 4.3% under the hyperoxic condition (P < 0.01, n = 6; Fig. 6B). The necrotic cell death after hyperoxic exposure in U0126-pretreated mtALDH-A549 cells was significantly lower than that in U0126-pretreated Neo-A549 cells (P < 0.001, n = 6; Fig. 6, A and B).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6. Inhibition of ERK activation results in increased necrotic cell death. A: necrotic cell death was measured in cells pretreated with 10 µM U0126 or nonpretreated cells after 48-h normoxic or hyperoxic exposure by Trypan blue exclusion assay. B: cytotoxicity was determined by LDH assay in pretreated (10 µM U0126) or nonpretreated cells after 48-h normoxic or hyperoxic exposure. n.s., Not significant.
|
|
We also analyzed PI3K-Akt activation in Neo-A549 and mtALDH-A549 cells by Western blotting. Under the normoxic condition, mtALDH stimulated Akt phosphorylation. The phosphorylated Akt was twofold higher in mtALDH-A549 cells than in Neo-A549 cells during the first 24-h culture under normoxic condition (Fig. 7, A and B). The total Akt levels in Neo-A549 and mtALDH-A549 cells were not significantly changed under normoxic condition (Fig. 7, A and C). Under the hyperoxic condition, phosphorylated Akt was slightly increased (Fig. 7D), and total Akt level was not significantly altered (Fig. 7E) in Neo-A549 cells. However, Akt phosphorylation was approximately two to three times higher in mtALDH-A549 cells than in Neo-A549 cells during 0-, 24-, and 48-h hyperoxic exposure (Fig. 7D). Before hyperoxic treatment (0 h), total Akt was increased
1.8-fold in mtALDH-A549 cells compared with Neo-A549 cells. The total Akt was not significantly altered in Neo-A549 and mtALDH-A549 cells during 24-, 48-, and 72-h hyperoxic exposure (Fig. 7, E and F).
Next, we pretreated Neo-A549 and mtALDH-A549 cells with or without 10 µM LY294002, a PI3K inhibitor, to inactivate PI3K. We measured necrotic cell death by Trypan blue exclusion and cytotoxicity assays after 48-h normoxic or hyperoxic exposure. The LY294002 pretreatment increased the necrotic cell death in Neo-A549 and mtALDH-A549 cells after 48-h normoxic or hyperoxic treatment. The necrotic cell death measured by Trypan blue exclusion assay in LY294002-pretreated Neo-A549 cells significantly increased to 9.0% from 4.2% under normoxic condition (P < 0.05, n = 6; Fig. 8A) and to 86.6% from 36.7% under hyperoxic condition (P < 0.001, n = 6; Fig. 8A). In LDH cytotoxicity assay, the necrotic cell death in LY294002-pretreated Neo-A549 cells increased to 10.4% from 0.7% under normoxic condition (P < 0.001, n = 6; Fig. 8B) and to 92.4% from 46.9% under hyperoxic condition (P < 0.001, n = 6; Fig. 8B). The necrotic cell death measured by Trypan blue exclusion assay in LY294002-pretreated mtALDH-A549 cells increased to 4.3% from 2.3% under normoxic condition [not significant (n.s.), n = 6; Fig. 8A] and to 28.0% from 18.7% under hyperoxic condition (P < 0.05, n = 6; Fig. 8A). In LDH cytotoxicity assay, the necrotic cell death in LY294002-pretreated mtALDH-A549 cells increased to 8.9% from 2.5% under normoxic condition (n.s., n = 6; Fig. 8B) and to 64.4% from 33.9% under hyperoxic condition (P < 0.001, n = 6; Fig. 8B). The necrotic cell death in LY294002-pretreated mtALDH-A549 cells after hyperoxic exposure was significantly lower than in LY294002-pretreated Neo-A549 cells (P < 0.001, n = 6; Fig. 8, A and B).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8. Inhibition of phosphatidylinositol 3-kinase (PI3K) activation results in increased necrotic cell death. A: necrotic cell death was measured by Trypan blue exclusion assay in cells pretreated with 10 µM LY294002 or nonpretreated cells after 48-h normoxic or hyperoxic exposure. B: cytotoxicity was determined by LDH assay in cells pretreated (10 µM LY294002) or nonpretreated after 48-h normoxic or hyperoxic exposure.
|
|
 |
DISCUSSION
|
|---|
In the present study, we demonstrated that hyperoxia downregulated mtALDH in the neonatal rat lung. In cultured lung epithelial cells, hyperoxia induced both apoptotic and nonapoptotic cell death. mtALDH overexpression in lung epithelial cells conferred cellular resistance to hyperoxia and significantly attenuated hyperoxia-induced cell death. The ROS production in cultured lung epithelial cells was elevated after hyperoxic exposure. Overexpression of mtALDH decreased intracellular and mitochondria-derived ROS production, indicating that mtALDH might have antioxidant and cytoprotective effects. mtALDH expression significantly stimulated ERK/MAPK and PI3K-Akt activation under normoxic and hyperoxic conditions. Inhibition of ERK/MAPK and PI3K-Akt activation eliminated cytoprotective effects of mtALDH, suggesting that mtALDH might activate ERK/MAPK and PI3K-Akt signaling pathways, which in turn could exert a cytoprotective role in cell survival during hyperoxia.
mtALDH is a nuclear-encoding mitochondrial protein, localized in the mitochondrial matrix. mtALDH is a reductase of acetaldehyde and converts acetaldehyde to acetic acid (25). It has been reported previously that deficiency of mtALDH increases cell susceptibility to oxidative stress, and it also increases the risks in the development of Alzheimer's disease (23, 24). Overexpression of mtALDH may detoxify acetaldehyde and prevent acetaldehyde-induced cell injury in human umbilical vein endothelial cells (19). mtALDH is expressed in lung (44), but its role in lung injury is not clear. Our proteomic analysis revealed that mtALDH was downregulated in the neonatal rat lungs after hyperoxic exposure. This finding indicates that mtALDH may be implicated in oxidative stress and cell death in hyperoxic lung injury.
Lung injury due to supplemental oxygen therapy is characterized by extensive pulmonary cell death (3, 5, 8). Hyperoxia induces lung epithelial cell death by activating apoptotic and nonapoptotic cell death pathways. Apoptosis in lung epithelial cells induced by hyperoxia is a highly regulated process. Hyperoxia can trigger either death receptor or mitochondria-mediated apoptosis pathway. For instance, hyperoxia induces apoptosis in lung epithelial cells via activation of Fas/FasL (12), increases of cytochrome c release from mitochondria (27), or activation of caspases (6). In cultured human lung type II epithelial cell line (A549), hyperoxia primarily induces necrotic cell death, although a small percentage of cell death may be due to apoptosis (13, 18, 21, 40). Our results also revealed that hyperoxia induced both apoptotic and nonapoptotic cell death in A549 lung epithelial cells, consistent with previous findings by other groups (13, 18, 21, 40). The prevention of cell death against hyperoxia in lung epithelial cells has been investigated extensively for its potential therapeutic use. Previous reports have demonstrated that growth factors (granulocyte macrophage colony-stimulating factor and keratinocyte growth factor) (28, 30) and antioxidant enzymes (heme oxygenase-1 and superoxide dismutase) (2, 33, 41, 42) have therapeutic effects on oxidative stress-related conditions, including hyperoxic lung injury. One of the important findings in this study was that overexpression of human mtALDH in A549 cells significantly reduced hyperoxia-induced apoptotic and nonapoptotic cell death. Thus it may be valuable to maintain an adequate level of mtALDH in the prevention and treatment of hyperoxic lung injury.
Hyperoxia increases ROS production in lung epithelial cells. The increased ROS level is primarily generated from mitochondria and other oxidases such as NADH oxidase (4, 38, 43). Increased ROS is extremely toxic, and it causes cell death and lung injury (8). Reduced ROS by antioxidants after hyperoxic exposure decreases cell death and lung injury (3). Our data demonstrated that mtALDH overexpression could reduce both intracellular and mitochondria-derived ROS production in lung epithelial cells during hyperoxic exposure. The reduced ROS in mtALDH-A549 cells may delay hyperoxia-induced cell death.
The activation of the ERK/MAPK pathway has been previously reported in lung epithelial cells after hyperoxic exposure. ERK activation in lung epithelial cells has a protective effect in hyperoxia-induced cell death, and it prolongs cell survival (7, 31, 39). For example, overexpression of 8-oxoguanine DNA glycosylase (hOgg1), a base excision DNA repair protein, protected hyperoxia-induced cell death via activation of ERK in A549 lung epithelial cells (17). The activation of ERK signaling after hyperoxic exposure has also been reported to increase Nrf2 translocation and antioxidant response element (ARE)-mediated gene expression involved in cellular protection (29). A recent report has indicated that downregulated phosphatase increases ERK/MAPK phosphorylation and reduces cell death in macrophage after hyperoxic exposure (45). It is not known whether the activation of ERK/MAPK by hyperoxia in lung epithelial cells is due to downregulation of phosphatase or occurs through other pathways. Our data further confirmed that hyperoxia activated the ERK/MAPK signaling pathway as a result of cellular response to oxidative stress. Additionally, we found that overexpression of mtALDH activated ERK/MAPK cell survival signaling under both normoxic and hyperoxic conditions. Activation of ERK/MAPK signaling by mtALDH attenuated hyperoxia-induced cell death and increased cell survival. When the activation of ERK/MAPK was inhibited by the MEK1/2 inhibitor U0126, there was increased necrotic cell death in Neo-A549 and mtALDH-A549 cells after hyperoxic exposure. However, the cell death after ERK/MAPK inactivation in mtALDH-A549 cells was significantly lower than in Neo-A549 cells, suggesting that ERK/MAPK activation by mtALDH may have a correlation with the cytoprotective effects and cell survival in lung epithelial cells.
Akt cell survival pathway is implicated in hyperoxia-induced cell death in lung epithelial cells. It has reported that prolonged hyperoxia not only diminishes Akt phosphorylation but also downregulates total Akt protein, which is one of the possible causes in hyperoxia-induced cell death (39). Our data demonstrate that mtALDH overexpression in A549 lung epithelial cells stimulates Akt activation under normoxic conditions. The activated Akt and total Akt are retained in mtALDH-A549 cells even under the hyperoxic condition. Constitutive expression of the active form of Akt has been shown to increase mouse survival under the hyperoxic condition (1, 20). Overexpression of growth factors such as keratinocyte growth factor increases Akt kinase activity and inhibits Fas/FasL-mediated apoptosis in lung epithelial cells (28, 30). Most recently, it has been demonstrated that overexpression of Cyr61, a novel stress-related protein, exerts cytoprotection in hyperoxia-induced pulmonary epithelial cell death, an effect in part mediated via the Akt signaling pathway (16). Our study demonstrated that inhibition of PI3K accelerated cell death in the lung epithelial cells that overexpressed mtALDH, suggesting that PI3K activation is required for the cytoprotective effect of mtALDH in the lung epithelial cells. Because PI3K activation leads to activation of Akt and several other downstream effectors such as PKC-
, PKC-
, and ERK, a more specific Akt inhibitor study is needed to provide conclusive information about the role of Akt in the cytoprotective mechanisms of mtALDH.
In the present study, it is still unclear how mtALDH overexpression activates ERK and Akt cell survival signaling pathways. The mechanisms of ERK and Akt activation by mtALDH might be different from hyperoxia-induced ERK and Akt activations, since ERK and Akt activation by mtALDH overexpression is, before hyperoxic exposure, without significant ROS alteration under our experimental conditions. mtALDH is a key enzyme in ethanol metabolism and involved in detoxification of aldehyde. Aldehyde is a toxic substance, and deficiency of mtALDH would cause accumulation of aldehyde in cells, which would induce oxidative stress and result in protein and lipid dysfunction. Further studies are needed to investigate how mtALDH overexpression activates ERK and Akt in lung epithelial cells.
In summary, mtALDH is downregulated in the neonatal rat lung after prolonged hyperoxic exposure. Overexpression of mtALDH confers lung epithelial cell resistance to hyperoxia-induced cell death. The cytoprotection of mtALDH in lung epithelial cell is mediated through ROS reduction and activation of ERK/MAPK and PI3K-Akt cell survival signaling pathways.
 |
GRANTS
|
|---|
This research work was supported by a Clinical Scholar Award and Katherine B. Richardson grants from Children's Mercy Hospital (D. Xu), a Hall Family Foundation grant (W. E. Truog and D. Xu), and National Heart, Lung, and Blood Institute Grant R-01-HL-70560 (W. E. Truog).
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. David Zwick from the clinical and research flow cytometry core facility at Children's Mercy Hospital for expertise in ROS and apoptotic cell death assays. We also thank Drs. Ikechukwu Ekekezie and Maria Navarro for discussion; Ruth Morgan, Mo Rezaiekhaligh, and Megan Spokes for technical support; and Dr. Toren Finkel from Cardiovascular Branch at National Heart, Lung, and Blood Institute for helpful comments and suggestions on the manuscript.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: D. Xu, Neonatology Research Laboratory, Children's Mercy Hospital, Pediatric Research Center, 4th Floor, 2401 Gillham Rd., Kansas City, MO 64108 (e-mail: xud{at}umkc.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Ahmad S, Ahmad A, Gerasimovskaya E, Stenmark KR, Allen CB, and White CW. Hypoxia protects human lung microvascular endothelial and epithelial-like cells against oxygen toxicity: role of phosphatidylinositol 3-kinase. Am J Respir Cell Mol Biol 28: 179187, 2003.[Abstract/Free Full Text]
- Ahmed MN, Suliman HB, Folz RJ, Nozik-Grayck E, Golson ML, Mason SN, and Auten RL. Extracellular superoxide dismutase protects lung development in hyperoxia-exposed newborn mice. Am J Respir Crit Care Med 167: 400538, 2003.[Abstract/Free Full Text]
- Asikainen TM and White CW. Pulmonary antioxidant defenses in the preterm newborn with respiratory distress and bronchopulmonary dysplasia in evolution: implications for antioxidant therapy. Antioxid Redox Signal 6: 155167, 2004.[CrossRef][Web of Science][Medline]
- Balaban RS, Nemoto S, and Finkel T. Mitochondria, oxidants, and aging. Cell 120: 483495, 2005.[CrossRef][Web of Science][Medline]
- Bourbon J, Boucherat O, Chailley-Heu B, and Delacourt C. Control mechanisms of lung alveolar development and their disorders in bronchopulmonary dysplasia. Pediatr Res 57: 38R46R, 2005.[CrossRef][Web of Science][Medline]
- Buccellato LJ, Tso M, Akinci OI, Chandel NS, and Budinger GR. Reactive oxygen species are required for hyperoxia-induced Bax activation and cell death in alveolar epithelial cells. J Biol Chem 279: 67536760, 2004.[Abstract/Free Full Text]
- Buckley S, Driscoll B, Barsky L, Weinberg K, Anderson K, and Warburton D. ERK activation protects against DNA damage and apoptosis in hyperoxic rat AEC2. Am J Physiol Lung Cell Mol Physiol 277: L159L166, 1999.[Abstract/Free Full Text]
- Chabot F, Mitchell JA, Gutteridge JM, and Evans TW. Reactive oxygen species in acute lung injury. Eur Respir J 11: 745757, 1998.[Abstract]
- Chen Z, Zhang J, and Stamler JS. Identification of the enzymatic mechanism of nitroglycerin bioactivation. Proc Natl Acad Sci USA 99: 83068311, 2002.[Abstract/Free Full Text]
- Chiu D, Ma K, Scott A, and Duronio V. Acute activation of Erk1/Erk2 and protein kinase B/akt proceed by independent pathways in multiple cell types. FEBS J 272: 43724384, 2005.[CrossRef][Medline]
- Comhair SA and Erzurum SC. Antioxidant responses to oxidant-mediated lung diseases. Am J Physiol Lung Cell Mol Physiol 283: L246L255, 2002.[Abstract/Free Full Text]
- De Paepe ME, Mao Q, Chao Y, Powell JL, Rubin LP, and Sharma S. Hyperoxia-induced apoptosis and Fas/FasL expression in lung epithelial cells. Am J Physiol Lung Cell Mol Physiol 289: L647L659, 2005.[Abstract/Free Full Text]
- Franek WR, Morrow DM, Zhu H, Vancurova I, Miskolci V, Darley-Usmar K, Simms HH, and Mantell LL. NF-kappaB protects lung epithelium against hyperoxia-induced nonapoptotic cell death-oncosis. Free Radic Biol Med 37: 16701679, 2004.[CrossRef][Web of Science][Medline]
- Frank L and Groseclose EE. Preparation for birth into an O2-rich environment: the antioxidant enzymes in the developing rabbit lung. Pediatr Res 18: 240244, 1984.[Web of Science][Medline]
- Janssen YM, Van Houten B, Borm PJ, and Mossman BT. Cell and tissue responses to oxidative damage. Lab Invest 69: 261274, 1993.[Web of Science][Medline]
- Jin Y, Kim HP, Ifedigbo E, Lau LF, and Choi AM. Cyr61 protects against hyperoxia-induced cell death via Akt pathway in pulmonary epithelial cells. Am J Respir Cell Mol Biol 33: 297302, 2005.[Abstract/Free Full Text]
- Kannan S, Pang H, Foster DC, Rao Z, and Wu M. Human 8-oxoguanine DNA glycosylase increases resistance to hyperoxic cytotoxicity in lung epithelial cells and involvement with altered MAPK activity. Cell Death Differ 13: 311323, 2005.[CrossRef]
- Kazzaz JA, Xu J, Palaia TA, Mantell L, Fein AM, and Horowitz S. Cellular oxygen toxicity. Oxidant injury without apoptosis. J Biol Chem 271: 1518215186, 1996.[Abstract/Free Full Text]
- Li SY, Gomelsky M, Duan J, Zhang Z, Gomelsky L, Zhang X, Epstein PN, and Ren J. Overexpression of aldehyde dehydrogenase-2 (ALDH2) transgene prevents acetaldehyde-induced cell injury in human umbilical vein endothelial cells: role of ERK and p38 mitogen-activated protein kinase. J Biol Chem 279: 1124411252, 2004.[Abstract/Free Full Text]
- Lu Y, Parkyn L, Otterbein LE, Kureishi Y, Walsh K, Ray A, and Ray P. Activated Akt protects the lung from oxidant-induced injury and delays death of mice. J Exp Med 193: 545549, 2001.[Abstract/Free Full Text]
- Mantell LL, Horowitz S, Davis JM, and Kazzaz JA. Hyperoxia-induced cell death in the lungthe correlation of apoptosis, necrosis, and inflammation. Ann NY Acad Sci 887: 171180, 1999.[Web of Science][Medline]
- Martin TR, Hagimoto N, Nakamura M, and Matute-Bello G. Apoptosis and epithelial injury in the lungs. Proc Am Thorac Soc 2: 214220, 2005.[Abstract/Free Full Text]
- Ohsawa I, Nishimaki K, Yasuda C, Kamino K, and Ohta S. Deficiency in a mitochondrial aldehyde dehydrogenase increases vulnerability to oxidative stress in PC12 cells. J Neurochem 84: 11101117, 2003.[CrossRef][Web of Science][Medline]
- Ohta S, Ohsawa I, Kamino K, Ando F, and Shimokata H. Mitochondrial ALDH2 deficiency as an oxidative stress. Ann NY Acad Sci 1011: 3644, 2004.[CrossRef][Web of Science][Medline]
- Oyama T, Isse T, Kagawa N, Kinaga T, Kim YD, Morita M, Sugio K, Weiner H, Yasumoto K, Kawamoto T. Tissue-distribution of aldehyde dehydrogenase 2 and effects of the ALDH2 gene-disruption on the expression of enzymes involved in alcohol metabolism. Front Biosci 10: 951960, 2005.[Web of Science][Medline]
- Pagano A and Barazzone-Argiroffo C. Alveolar cell death in hyperoxia-induced lung injury. Ann NY Acad Sci 1010: 405416, 2003.[CrossRef][Web of Science][Medline]
- Pagano A, Donati Y, Metrailler I, and Barazzone Argiroffo C. Mitochondrial cytochrome c release is a key event in hyperoxia-induced lung injury: protection by cyclosporin A. Am J Physiol Lung Cell Mol Physiol 286: L275L283, 2004.[Abstract/Free Full Text]
- Paine R 3rd, Wilcoxen SE, Morris SB, Sartori C, Baleeiro CE, Matthay MA, and Christensen PJ. Transgenic overexpression of granulocyte macrophage-colony stimulating factor in the lung prevents hyperoxic lung injury. Am J Pathol 163: 23972406, 2003.[Abstract/Free Full Text]
- Papaiahgari S, Kleeberger SR, Cho HY, Kalvakolanu DV, and Reddy SP. NADPH oxidase and ERK signaling regulates hyperoxia-induced Nrf2-ARE transcriptional response in pulmonary epithelial cells. J Biol Chem 279: 4230242312, 2004.[Abstract/Free Full Text]
- Ray P, Devaux Y, Stolz DB, Yarlagadda M, Watkins SC, Lu Y, Chen L, Yang XF, and Ray A. Inducible expression of keratinocyte growth factor (KGF) in mice inhibits lung epithelial cell death induced by hyperoxia. Proc Natl Acad Sci USA 100: 60986103, 2003.[Abstract/Free Full Text]
- Romashko J 3rd, Horowitz S, Franek WR, Palaia T, Miller EJ, Lin A, Birrer MJ, Scott W, and Mantell LL. MAPK pathways mediate hyperoxia-induced oncotic cell death in lung epithelial cells. Free Radic Biol Med 35: 978993, 2003.[CrossRef][Web of Science][Medline]
- Ruchko M, Gorodnya O, LeDoux SP, Alexeyev MF, Al-Mehdi AB, and Gillespie MN. Mitochondrial DNA damage triggers mitochondrial dysfunction and apoptosis in oxidant-challenged lung endothelial cells. Am J Physiol Lung Cell Mol Physiol 288: L530L535, 2005.[Abstract/Free Full Text]
- Ryter SW and Choi AM. Heme oxygenase-1: redox regulation of a stress protein in lung and cell culture models. Antioxid Redox Signal 7: 8091, 2005.[CrossRef][Web of Science][Medline]
- Shaffer SG, Bradt SK, and Thibeault DW. Chronic vascular pulmonary dysplasia associated with neonatal hyperoxia exposure in the rat. Pediatr Res 21: 1420, 1987.[Web of Science][Medline]
- Sigaud S, Evelson P, and Gonzalez-Flecha B. H2O2-induced proliferation of primary alveolar epithelial cells is mediated by MAP kinases. Antioxid Redox Signal 7: 613, 2005.[CrossRef][Web of Science][Medline]
- Spragg RG. DNA strand break formation following exposure of bovine pulmonary artery and aortic endothelial cells to reactive oxygen products. Am J Respir Cell Mol Biol 4: 410, 1991.[Web of Science][Medline]
- Tanswell AK and Freeman BA. Pulmonary antioxidant enzyme maturation in the fetal and neonatal rats. 1. Developmental profiles. Pediatr Res 18: 584587, 1984.[Web of Science][Medline]
- Thannickal VJ and Fanburg BL. Activation of an H2O2-generating NADH oxidase in human lung fibroblasts by transforming growth factor beta 1. J Biol Chem 270: 3033430338, 1995.[Abstract/Free Full Text]
- Truong SV, Monick MM, Yarovinsky TO, Powers LS, Nyunoya T, and Hunninghake GW. Extracellular signal-regulated kinase activation delays hyperoxia-induced epithelial cell death in conditions of Akt downregulation. Am J Respir Cell Mol Biol 31: 611618, 2004.[Abstract/Free Full Text]
- Wang X, Ryter SW, Dai C, Tang ZL, Watkins SC, Yin XM, Song R, and Choi AM. Necrotic cell death in response to oxidant stress involves the activation of the apoptogenic caspase-8/bid pathway. J Biol Chem 278: 2918429191, 2003.[Abstract/Free Full Text]
- White CW, Avraham KB, Shanley PF, and Groner Y. Transgenic mice with expression of elevated levels of copper-zinc superoxide dismutase in the lungs are resistant to pulmonary oxygen toxicity. J Clin Invest 87: 21622168, 1991.[Web of Science][Medline]
- Wispe JR, Warner BB, Clark JC, Dey CR, and Neuman J. Human Mn-superoxide dismutase in pulmonary epithelial cells of transgenic mice confers protection from oxygen injury. J Biol Chem 267: 2393723941, 1992.[Abstract/Free Full Text]
- Xu D and Finkel T. A role for mitochondria as potential regulators of cellular life span. Biochem Biophys Res Commun 294: 245248, 2002.[CrossRef][Web of Science][Medline]
- Yoon M, Madden MC, and Barton HA. Developmental expression of aldehyde dehydrogenase in rat: a comparison of liver and lung development. Toxicol Sci 89: 386398, 2006.[Abstract/Free Full Text]
- Yunoya T, Monick MM, Powers LS, Yarovinsky TO, and Hunninghake GW. Macrophages survive hyperoxia via prolonged ERK activation due to phosphatase down-regulation. J Biol Chem 280: 2629526302, 2005.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
D. Xu, R. E. Perez, M. H. Rezaiekhaligh, M. Bourdi, and W. E. Truog
Knockdown of ERp57 increases BiP/GRP78 induction and protects against hyperoxia and tunicamycin-induced apoptosis
Am J Physiol Lung Cell Mol Physiol,
July 1, 2009;
297(1):
L44 - L51.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Mao, S. Gundavarapu, C. Patel, A. Tsai, F. I. Luks, and M. E. De Paepe
The Fas System Confers Protection against Alveolar Disruption in Hyperoxia-Exposed Newborn Mice
Am. J. Respir. Cell Mol. Biol.,
December 1, 2008;
39(6):
717 - 729.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Xu, R. E. Perez, I. I. Ekekezie, A. Navarro, and W. E. Truog
Epidermal growth factor-like domain 7 protects endothelial cells from hyperoxia-induced cell death
Am J Physiol Lung Cell Mol Physiol,
January 1, 2008;
294(1):
L17 - L23.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2006 by the American Physiological Society.