AJP - Lung AJP: Cell Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 291: L1207-L1219, 2006. First published August 4, 2006; doi:10.1152/ajplung.00376.2005
1040-0605/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/6/L1207    most recent
00376.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leroy, C.
Right arrow Articles by Brochiero, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leroy, C.
Right arrow Articles by Brochiero, E.

Regulation of ENaC and CFTR expression with K+ channel modulators and effect on fluid absorption across alveolar epithelial cells

Claudie Leroy,1 Anik Privé,1 Jean-Charles Bourret,1,2 Yves Berthiaume,1,2 Pasquale Ferraro,1,3 and Emmanuelle Brochiero1,2

1Centre de recherche, Centre hospitalier de l'Université de Montréal-Hôtel-Dieu, 2Département de médecine and 3Département de chirurgie, Université de Montréal, Montréal, Québec, Canada

Submitted 29 August 2005 ; accepted in final form 21 July 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In a recent study (Leroy C, Dagenais A, Berthiaume Y, and Brochiero E. Am J Physiol Lung Cell Mol Physiol 286: L1027–L1037, 2004), we identified an ATP-sensitive K+ (KATP) channel in alveolar epithelial cells, formed by inwardly rectifying K+ channel Kir6.1/sulfonylurea receptor (SUR)2B subunits. We found that short applications of KATP, voltage-dependent K+ channel KvLQT1, and calcium-activated K+ (KCa) channel modulators modified Na+ and Cl currents in alveolar monolayers. In addition, it was shown previously that a KATP opener increased alveolar liquid clearance in human lungs by a mechanism possibly related to epithelial sodium channels (ENaC). We therefore hypothesized that prolonged treatment with K+ channel modulators could induce a sustained regulation of ENaC activity and/or expression. Alveolar monolayers were treated for 24 h with inhibitors of KATP, KvLQT1, and KCa channels identified by PCR. Glibenclamide and clofilium (KATP and KvLQT1 inhibitors) strongly reduced basal transepithelial current, amiloride-sensitive Na+ current, and forskolin-activated Cl currents, whereas pinacidil, a KATP activator, increased them. Interestingly, K+ inhibitors or membrane depolarization (induced by valinomycin in high-K+ medium) decreased {alpha}-, beta-, and {gamma}-ENaC and CFTR mRNA. {alpha}-ENaC and CFTR proteins also declined after glibenclamide or clofilium treatment. Conversely, pinacidil augmented ENaC and CFTR mRNAs and proteins. Since alveolar fluid transport was found to be driven, at least in part, by Na+ transport through ENaC, we tested the impact of K+ channel modulators on fluid absorption across alveolar monolayers. We found that glibenclamide and clofilium reduced fluid absorption to a level similar to that seen in the presence of amiloride, whereas pinacidil slightly enhanced it. Long-term regulation of ENaC and CFTR expression by K+ channel activity could benefit patients with pulmonary diseases affecting ion transport and fluid clearance.

lung; ATP-sensitive K+ channel; KVLQT1; calcium-activated K+ channel; Na+ and Cl transepithelial transport; alveolar clearance


IT HAS BEEN WELL ESTABLISHED that fluid absorption and secretion across alveolar or tracheobronchial epithelia (2, 7, 8, 38) are mainly driven by transepithelial transport of Na+ and Cl. Effective control of Na+ and Cl transepithelial transport is then essential for periciliary volume and mucociliary clearance in airways, processes that are dysfunctional in cystic fibrosis (7, 8). In alveoli, Na+ and Cl transport in alveolar epithelial type II (5) and type I (26) cells is also essential for fluid absorption at birth as well as in adult lungs for the resolution of pathological conditions such as pulmonary edema.

Cl secretion via the CFTR (20), Na+ transport through epithelial sodium channels (ENaC) (37, 42), and liquid clearance (3, 6, 25) can be stimulated by pharmacological agents such as beta-adrenergic agonists and cAMP analogs. However, it was recently shown that Na+ and Cl transport can also be controlled by K+ channel activity. Indeed, we recently demonstrated (31) the presence of an ATP-sensitive K+ (KATP) channel, formed by inwardly rectifying K+ channel Kir6.1 and sulfonylurea receptor SUR2B subunits, in alveolar epithelial cells. Acute application of KATP modulators can control Na+ and Cl transport. In addition, a previous study (53) revealed that treatment with YM-934, a KATP channel opener, increased alveolar liquid clearance in human lungs (53). It was also observed that glibenclamide and amiloride inhibited this response. These results suggested that KATP activation might stimulate Na+ transport in the lungs, which has been identified as the main mechanism involved in alveolar liquid clearance (4). However, sustained increased Na+ transport in the alveolar epithelium by long-term treatment with KATP activators has never been directly demonstrated, and the mechanisms of activation have not been clearly defined.

Other classes of K+ channels could be important for fluid secretion and absorption in alveolar epithelial cells, since they have been found to modulate ion transport in airway epithelia. Indeed, voltage-dependent K+ KvLQT1 channels and calcium-activated K+ (KCa) channels have been identified as key elements of ion transport. A severe reduction of Cl secretion has been reported after inhibition of KvLQT1 and intermediate-conductance, calcium-activated K+ (IKCa) channels in nasal and bronchial cells (12, 34, 35). More interestingly, it has been observed that IKCa channel openers stimulate Cl secretion in Calu-3 cells (16, 56), in primary cultures of human bronchial epithelia (56), and in nasal cells (35). It has, therefore, been proposed that these agents could constitute a promising strategy to stimulate Cl secretion, via residual CFTR channels or alternative calcium-activated Cl channels (35), in cystic fibrosis. These KvLQT1 (14, 23, 36) and calcium-activated K+ channels [high-conductance KCa (maxi-KCa, Slo1; Refs. 28, 29) and IKCa (Refs. 12, 39)] are well distributed in the upper airways. However, their presence was not clearly demonstrated in alveolar epithelia, even if our recent results (31) indicated their activity in alveolar epithelial cells in primary culture.

The aim of our study was first to verify the presence of KvLQT1 and KCa channels and to determine their molecular identity in alveolar epithelial cells. Their expression in freshly isolated and cultured alveolar cells was also compared. Second, we tried to establish whether long-term treatment with modulators of KvLQT1, KCa, and KATP channels could induce sustained regulation of Na+ and Cl currents as well as ENaC and CFTR expression in cultured alveolar cells. Finally, we studied the impact of Na+ and Cl transport regulation by K+ channel modulators on fluid transport across alveolar epithelial cell monolayers.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Alveolar Epithelial Type II Cell Isolation and Primary Culture

Alveolar epithelial type II cells were isolated from male Sprague-Dawley rats according to a well-established protocol (22, 31). In brief, the lungs were washed to remove blood cells and alveolar macrophages before treatment with elastase. They were then minced, and the resulting suspensions were filtered. Alveolar cells were collected and purified by a differential adherence technique (17), which enhances the purity of the alveolar type II cell pool to 86% (10, 31). This freshly isolated cell suspension was used directly or cultured in Eagle's minimum essential medium (MEM)-FBS medium on Costar Transwell permeant filters (4 cm2, Costar Transwell, Toronto, ON, Canada; 1 x 106 cells/cm2), as described previously (31).

Molecular Biology

RNA purification. Total RNA from alveolar epithelial cells (freshly isolated or cultured on filters for 1–4 days) was purified with TRIzol reagent according to the manufacturer's instructions (Invitrogen, Burlington, ON, Canada).

Polymerase chain reaction amplification of ionic channels. Five micrograms of total RNA, purified from freshly isolated or cultured alveolar epithelial cells, was reverse-transcribed to cDNA with Moloney murine leukemia virus reverse transcriptase (RT, Invitrogen) in the presence of (oligo)dT primers. cDNAs were amplified with Taq polymerase (Invitrogen), using specific primers designed from sequences of the following cloned K+ channels: rat KvLQT1 (Ref. 27, GenBank Accession No. AJ133685), Slo1 (GenBank Accession No. NM031828), IKCa (Ref. 45; GenBank Accession Number NM023021). KvLQT1 primers (sense 5'-cccatctcagaaaagagcaa-3', antisense 5'-tcttggtgagctccagattc-3'; 1 µM final concentration of each, 462-bp PCR product), Slo1 primer pair (sense 5'-gctgatttaagggctgtcaa-3', antisense 5'-agggtccgtattagggtgag-3'; 1 µM, 461-bp PCR product), and IKCa primers (sense 5'-gctgttcatgactgacaacg-3', antisense 5'-catagccaatggtcaggaac-3'; 1 µM, 500-bp PCR product) were used to explore the presence of these K+ channels in alveolar cells. The PCR primer pair for CFTR (sense 5'-aggagactgtccctggttcc-3' and antisense 5'-tggcaattttagtgccattg-3'; 1 µM) amplified a specific product of 499 bp as previously described (10). PCR primer pairs for {alpha}-ENaC (sense 5'-gagcctgcctttatggatga-3' and antisense 5'-gagctttgcaactccgtttc-3'), beta-ENaC (sense 5'-tacagtccctgcaccatgaa-3' and antisense 5'-ccacccaggttagagagcag-3'), and {gamma}-ENaC (sense 5'-ccgagaaatggttgctgaat-3' and antisense 5'-gtgtctgtgagctgggatga-3') amplified specific products of 500, 500, and 502 bp, respectively, as previously described (13). Finally, the beta-actin primer pair (sense 5'-ctaaggccaaccgtgaaaag-3' and antisense gccatctcttgctcgaagtc; 0.25 µM) amplified a 311-bp product (10, 13). Primer pairs were designed in distinct exons to avoid genomic DNA amplification. Semiquantitative RT-PCR amplification was undertaken according to a well-established laboratory protocol (10, 13, 31). Briefly, a curve of cDNA amplification in function of the number of amplification cycles was first charted for each primer pair to define the optimum number of cycles in the linear phase of amplification. The Slo1 product was amplified for 30 cycles, IKCa for 26 cycles, KvLQT1 and CFTR for 25 cycles, {alpha}-ENaC and beta-ENaC for 21 cycles, and {gamma}-ENaC for 24 cycles, whereas beta-actin amplification was stopped after 18 cycles. Since beta-actin amplification remains stable under all tested conditions, even in the linear phase of amplification (31), PCR products were normalized to the beta-actin signal for each cDNA sample. The RT-PCR products were finally separated on agarose gels, stained with ethidium bromide and analyzed with the Typhoon Gel Imager (10, 13, 31).

Sequencing. The 462-, 461-, and 500-bp bands obtained with KvLQT1, Slo1, and IKCa primers, respectively, were extracted from agarose gel with QIAEXII (Qiagen, Mississauga, ON, Canada), according to the manufacturer's instructions and purified by filtration on Microcon-PCR filters (Amicon, Beverly, MA). The nucleotide sequences of the purified products were confirmed by sequencing at the Centre hospitalier de l'Université de Montréal (CHUM) sequencing facilities with a ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA). The identity of ENaC and CFTR products has already been confirmed by sequencing in previous studies (10, 13).

Immunoblotting

Total proteins were extracted from alveolar cells (obtained from at least 5 different rats), cultured on permeant filters for 3 days, and treated or not with K+ channel modulators for an additional 24 h before extraction. After the monolayers were washed twice with PBS, the cells were detached by gentle scraping, and the suspension was centrifuged at 2,800 g at 4°C.

For CFTR detection, proteins were extracted in RIPA buffer, denatured on ice in sample buffer A (50 mM Tris·HCl, 2% SDS, 0.1% bromophenol blue, 10% glycerol, and 125 mM DTT), and then separated by polyacrylamide gel electrophoresis (6.5%) (10). CFTR protein of alveolar extract (120 µg) was detected with an anti-CFTR primary antibody (1:500, H-182; Santa Cruz Biotechnology, Santa Cruz, CA). Specificity of the antibody was confirmed (10) in BHK cells transfected with CFTR (a gift from Dr. J. Hanrahan, McGill University, Montreal, QC, Canada) and NuLi 1 (kindly provided by Dr. J. Zabner, University of Iowa, Iowa City, IA) as positive controls (175-kDa band). No band could be detected with BHK cells stably transfected with empty pNUT vector (negative control; a gift from Dr. J. Hanrahan). In alveolar cells, the observed 164-kDa band was consistent with mature rat CFTR (150–165 kDa) (44).

An adapted immunoblotting protocol was adopted for {alpha}-ENaC, Kir6.1, KvLQT1, IKCa, and maxi-KCa detection. The cell pellet was solubilized in lysate solution [150 mM NaCl, 50 mM Tris·HCl, pH 7.6, 1% Triton X-100, 0.1% SDS, protease cocktail (Complete Mini EDTA-free protease inhibitor cocktail, Roche, Mannheim, Germany)] for 1 h on ice and centrifuged at 12,000 g for 5 min. The supernatants were collected, and protein contents were estimated by Coomassie blue assay (Bradford, Pierce, Rockford, IL) with BSA as standard. Proteins were then solubilized at 95°C for 5 min in sample buffer B (62.5 mM Tris·HCl, pH 6.8, 2% SDS, 10% glycerol, 0.2% bromophenol blue, 4% beta-mercaptoethanol). Proteins (50 µg for {alpha}-ENaC, 40 µg for Kir6.1 and KvLQT1, 120–135 µg for IKCa and maxi-KCa) were separated by polyacrylamide gel electrophoresis (7.5%) and transferred onto polyvinylidene difluoride membranes. The blots were first blocked with 5% milk in Tris-buffered saline (TBS)-Tween (TBST, 500 mM NaCl, 20 mM Tris·HCl, and 0.1% Tween 20, pH 7.4) for 1 h at room temperature or overnight at 4°C and then stained with commercial anti-{alpha}-ENaC antibody (dilution 1:1,000, PA1-920; Affinity BioReagents, Golden, CO), anti-Kir6.1 (dilution 1:200, sc-11224, Santa Cruz Biotechnology), anti-KvLQT1 (dilution 1:500, sc-10645, Santa Cruz Biotechnology), anti-IKCa (dilution 1:300, P4997, Sigma-Aldrich), or anti-maxi-KCa (dilution 1:200, APC-021, Alomone Labs, Jerusalem, Israel) in TBST plus 10% milk for 16 h at 4°C. The membranes were washed three times in TBST for 15 min and once in TBS for 15 min and then incubated with the secondary antibody anti-rabbit IgG (1:2,000; Bio-Rad, Mississauga, ON, Canada; for ENaC, IKCa, and maxi-KCa) or with anti-goat (1:4,000; Santa Cruz Biotechnology; for Kir6.1 and KvLQT1) linked to horseradish peroxidase in TBST plus 10% milk for 1 h at room temperature. They were washed three times in TBST for 15 min and once in TBS for 15 min before development (for 5 min) with chemiluminescence reagent (ECL Plus; Amersham, Little Chalfont, UK). Finally, a diagnostic film (Kodak, Rochester, NY) was exposed with the membranes for 10 s up to 3 min. The anti-{alpha}-ENaC antibody (PA1-920) recognized a 83- to 90-kDa band in alveolar epithelial cell extracts (13, 61). The specificity of this antibody was verified with its blocking peptide (PA1-920-neutralizing peptide PEP-088, Affinity BioReagents). In addition, protein extracts (a gift from Dr. D. Rotin, Sick Children's Hospital, Toronto, ON, Canada) from untransfected Madin-Darby canine kidney (MDCK) cells (1 µg of protein) and transfected MDCK cells with rat {alpha}-ENaC tagged with the influenza hemagglutinin epitope (1 µg of protein) were negative and positive controls, respectively (~97 kDa). The anti-Kir6.1, anti-KvLQT1, and anti-IKCa antibodies recognized ~50- (54), 75- (32), and ~55-kDa bands, respectively. The specificity of anti-Kir6.1 and anti-KvLQT1 antibodies was verified with their respective blocking peptides (sc-11224P and sc10645P, Santa Cruz Biotechnology). Unfortunately, the specificity of the 55-kDa band detected with anti-IKCa antibody was not verified because the blocking peptide (Sigma-Aldrich) was unavailable.

Electrophysiology

Alveolar epithelial cells were cultured on filters (Costar Transwell, 4 cm2) for 3 days until they formed a tight epithelium (>1,200 {Omega}·cm2). The monolayers were then treated for 24 h with K+ channel modulators. The electrophysiological characteristics of alveolar monolayers were studied with an epithelial voltohmeter (EVOM; World Precision Instruments, Sarasota, FL; Ref. 13) or by short-circuit current (Isc) measurements in a Ussing chamber (31). The EVOM successively recorded potential differences (PD, mV) generated by the cell monolayers and transepithelial resistance (Rte, {Omega}·cm2) across the cell monolayers. Transepithelial current (Ite) across the monolayers was then calculated according to the following formula: Ite = PD/Rte (13). To quantify the amount of amiloride-sensitive current generated by intact alveolar monolayers treated for 24 h with or without K+ channel inhibitors, Ite was measured successively before and 5 min after incubation with 1 µM amiloride (apical side). The monolayers were then treated with 10 µM forskolin (basolateral side) for a 55-min period in the presence of amiloride to quantify the effect of increasing cAMP levels on Cl currents.

For Isc measurements, alveolar monolayers were mounted in a heated (37°C) Ussing chamber and perfused on the apical and basolateral sides with warm normal physiological solution (containing in mM: 141 NaCl, 5.4 KCl, 0.78 NaH2PO4, 0.8 MgCl2, 1.8 CaCl2, 5 glucose and 15 HEPES, pH 7.4). Transepithelial PD was clamped to zero by an external voltage-clamp amplifier (VCCMC2, Physiological Instruments) with KCl agar-calomel half-cells and Ag-AgCl electrodes, and the resulting Isc was recorded continuously on a computer with a PowerLab system (ADInstrument, Toronto, ON, Canada; Ref. 31). To quantify the amount of active ENaC and CFTR channels at the apical membrane after treatment with K+ channel modulators, Isc was measured after establishment of a Na+ or Cl gradient and permeabilization of the basolateral membrane with amphotericin B (7.5 µM). The apical-to-basolateral Na+ gradient was created by bathing the apical side with normal physiological solution and replacing 116 mM NaCl by an equivalent amount of NMDG-Cl for the basolateral side. A basolateral-to-apical Cl gradient was established with a normal physiological solution at the basolateral side and a low-Cl solution at the apical side (116 mM NaCl replaced by 116 mM Na gluconate).

Fluid Transport Across Alveolar Epithelial Cell Monolayers

Fluid transport across alveolar monolayers was measured with 125I-labeled albumin as a volume marker, following a method adapted from Fang et al. (21). Twenty-four and forty-eight hours after seeding, the culture medium at the apical side of the alveolar epithelial monolayers was removed to create an air-liquid interface (ALI). At day 4, 1.5 ml of culture medium (MEM-10% FBS) containing 0.5 µCi/ml 125I-albumin was added to the apical side of the monolayers. At the same time, the monolayers were treated with ion channel modulators. Amiloride (10 µM) was added at the apical side in 125I-albumin-containing MEM. Clofilium (5 µM), glibenclamide (100 µM), or pinacidil (100 µM) was applied at the basolateral side of the monolayers. The cells were then incubated at 37°C with 5% CO2 in an humidified incubator. After 5 min (t5), 250 µl of the apical medium was collected (corresponding to the initial sample). Monolayers were then laid in the incubator for a 24-h period, when a second 250-µl aliquot was collected (t24). The t5 and t24 samples were weighed and counted in a gamma counter (Cobra Auto-gamma, Packard) for 5 min. Fluid transport was calculated according to the following formula: fluid absorption (in %) = [1 – (cpm of t5 sample/weight of t5 sample)/(cpm of t24 sample/weight of t24 sample)] x 100, where cpm is counts per minute. The absorbed volume was then calculated in microliters per square centimeter per hour, and the results are presented as percentage of fluid absorption across control untreated monolayers. Permeability to protein (Pp) was also estimated in each monolayer. The remaining apical and basolateral media were collected; the monolayers were washed with H2O, and the washing medium was collected and counted. Pp of each monolayer was calculated according to the following formula: Pp = (cpm of basolateral compartment)/(cpm of apical compartment), where cpm of the apical compartment was cpm of the t5 sample + cpm of the t24 sample + cpm of the remaining apical volume + cpm of the apical washing solution. Mean Pp was 0.57 ± 0.05%; monolayers with Pp >3% were discarded. Free 125I measured in the presence of trichloroacetic acid (20%) was <2.5%. Evaporative loss of fluid measured in an empty, Parafilm-sealed Transwell membrane was null.

Statistics

Average values are given as means ± SE; n represents the number of experiments that were performed on at least four different animals. Comparisons between groups were made by one-group or paired t-test with Statview software (SAS Institute, Cary, NC). A probability of P < 0.05 was considered to be significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Molecular Identity and Expression of K+ Channels in Alveolar Epithelial Cells

IKCa and Slo1 primer pairs, designed from intermediate- and high-conductance calcium-activated K+ channels, respectively, amplified 500- and 461-bp products from the cDNA of freshly isolated alveolar cells, as expected (Fig. 1A). In addition, a 462-bp product could be amplified with the KvLQT1 primer pair. These 500-, 461-, and 462-bp bands were extracted and purified. Sequencing of the purified products confirmed 100% identity to cloned rat IKCa (GenBank Accession no. NM023021), rat Slo1 (maxi-KCa, GenBank Accession no. NM031828), and rat KvLQT1 (GenBank Accession no. AJ133685). The results demonstrated the presence of KvLQT1 mRNA as well as IKCa and Slo1 mRNAs coding for intermediate- and large-conductance KCa channels, respectively, in alveolar epithelial cells.


Figure 1
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Molecular identity and expression of K+ channels in freshly isolated and cultured alveolar epithelial cells. A: agarose gels showing RT-PCR products amplified from freshly isolated rat alveolar epithelial cell cDNA with PCR primer pairs designed from cloned rat intermediate-conductance calcium-activated K+ (IKCa) channel, rat maxi-conductance KCa (Slo1), and voltage-dependent K+ channel KvLQT1. Primers are described in MATERIALS AND METHODS. M, marker. B: densitometric semiquantification of KvLQT1, Slo, and IKCa cDNA expression from freshly isolated alveolar epithelial cells (time 0) and alveolar monolayers in primary culture for 1, 2, 3, and 4 days, normalized with beta-actin expression and shown as % of the signal observed on day 0 (n = 5). C: detection of KvLQT1 (KvLQT1-Ab) and inwardly rectifying K+ channel Kir6.1 (Kir6.1-Ab) proteins by Western blot analysis of a representative (from at least 5 different animals) epithelial alveolar cell lysate (cultured for 4 days on permeant filters, 40 µg protein). Specificity of the antibodies was confirmed with their neutralizing peptide (KvLQT1-Ab + peptide, Kir6.1-Ab + peptide).

 
Since we recently found (31) that expression of the Kir6.1 and SUR2B subunits (forming the alveolar KATP channel) changed as a function of time of culture (initial decrease between days 0 and 2, followed by an increase on days 3 and 4), we decided to track and compare the expression of IKCa, Slo1, and KvLQT1 mRNA in culture. As observed in Fig. 1B, KvLQT1 expression decreased by 29 ± 7% (P = 0.015) between freshly isolated (day 0) alveolar cells and alveolar cell monolayers cultured on filters until day 4 (when the electrophysiological experiments were performed). Conversely, there was a nonsignificant increase of IKCa and Slo1 expression between days 0 and 4.

Expression of KvLQT1, Kir6.1, IKCa, and Slo1 at the protein level was then explored. Goat polyclonal antibodies raised against peptides mapping near the COOH terminus of KvLQT1 or Kir6.1 proteins detected 75- and ~50-kDa bands, the expected molecular mass of KvLQT1 and Kir6.1, respectively (Fig. 1C). The specificities of these antibodies were verified with their respective neutralizing peptides (Fig. 1C). The rabbit anti-IKCa antibody detected several bands, one of them at ~55 kDa, the expected mass of IKCa (data not shown). However, the specificity of this band could not be verified because the blocking peptide was unavailable. Finally, an anti-rabbit maxi-KCa (Slo1) antibody did not detect any band in alveolar cell extracts (50- to 120-µg proteins).

Effect of Long-Term Treatment with K+ Channel Modulators on Transepithelial Currents in Alveolar Epithelial Cells

Effect of long-term treatment with KATP, KvLQT1, and KCa inhibitors in intact alveolar monolayers. We have already shown (31) that short-term treatment with KATP, KvLQT1, and KCa channel inhibitors reduced Na+ and Cl currents in alveolar epithelial cell monolayers. We now tried to determine whether prolonged application of K+ channel inhibitors (24-h treatment) could induce sustained modulation of Na+ and Cl currents.

In nontreated monolayers, mean basal Ite was 5.0 ± 0.1 µA/cm2 (n = 97). It was significantly reduced by 60% and 68% (P < 0.0001) by 24-h treatment with glibenclamide (100 µM, basolateral side; an inhibitor of KATP; Fig. 2A; n = 14) and clofilium (5 µM, basolateral side; an inhibitor of KvLQT1; Fig. 2D; n = 14), respectively. Clotrimazole (20 µM), an inhibitor of IKCa channels, also significantly decreased basal Ite (25% inhibition, P < 0.0001; n = 18). Other inhibitors of KCa channels, charybdotoxin (200 nM; an inhibitor of maxi-KCa and IKCa channels), Tram34 (5 µM; an inhibitor of IKCa channels), and iberiotoxin (100 nM; an inhibitor of maxi-KCa channels), elicited nonsignificant declines of basal Ite.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
 
Fig. 2. Effect of KvLQT1 and ATP-sensitive K+ (KATP) channel inhibitors on transepithelial currents of epithelial alveolar monolayers. The transepithelial currents (Ite) of cultured alveolar monolayers were measured with a voltohmeter on nontreated filters (control) and on filters treated at the basolateral side for 24 h with glibenclamide (glib, 100 µM;, n = 14; A–C) or clofilium (clofi, 5 µM; n = 14; D–F). Inhibitors were washed before Ite measurements. Mean basal Ite (Ite-basal; A and D) were measured first. Amiloride (1 µM) was then applied to the apical side of the monolayers to determine the amiloride-sensitive current (Ite-amil; B and E) corresponding to epithelial sodium channel (ENaC) currents. Finally, forskolin (10 µM, basolateral side) was applied in the presence of amiloride to stimulate Cl currents (Ite-Fk; C and F). Ite-amil and Ite-Fk were compared in control monolayers and in monolayers treated with glibenclamide (B and C) and clofilium (E and F). The mean difference between control and treated currents is also indicated, with the significance.

 
Treatment with K+ channel inhibitors also influenced amiloride-sensitive Na+ currents. In control monolayers, 65 ± 1% of basal Ite was sensitive to amiloride (Ite-amil of 3.2 ± 0.1 µA/cm2; n = 97). Ite-amil was decreased by 74% (P = 0.0003, n = 14) and 75% (P < 0.0001, n = 14) with glibenclamide (Fig. 2B) and clofilium (Fig. 2E), respectively. Like basal Ite, Ite-amil was poorly reduced by KCa inhibitors; only clotrimazole significantly diminished Ite-amil, by 29% (P < 0.0001; n = 18).

Finally, the impact of K+ channel inhibitors was tested on cAMP-stimulated Cl currents. After ENaC inhibition by amiloride, elevation of cAMP levels with forskolin (10 µM, basolateral side) elicited a progressive increase in Ite from 1.7 ± 0.1 to 4.1 ± 0.1 µA/cm2 after 1 h (i.e., 143.8 ± 3.8% rise; n = 97). This forskolin-induced Cl current (Ite-Fk; 2.4 ± 0.1 µA/cm2) was totally suppressed by 5-nitro-2-(3-phenylpropylamino)benzoic acid (NPPB), an inhibitor of anion conductance. Ite-Fk was also reduced by 41% (P = 0.0012, n = 14; Fig. 2C) and 46% (P = 0.0001, n = 14; Fig. 2F) by basolateral glibenclamide and clofilium, respectively. The effect of glibenclamide was specifically due to the inhibition of basolateral KATP channels, since apical treatment with glibenclamide (100 µM, 24 h) had no significant effect on basal Ite, Ite-amil, and Ite-Fk (data not shown). Some KCa channel inhibitors, more precisely charybdotoxin, iberiotoxin, clotrimazole, and Tram34, inhibited Ite-Fk by 13% (P = 0.028, n = 20), 11% [not significant (NS), n = 14], 18% (P = 0.0005, n = 18), and 22% (P = 0.04, n = 10), respectively.

Effect of long-term K+ channel inhibition on amiloride-sensitive currents in basolaterally permeabilized alveolar monolayers. The impact of long-term inhibition of K+ channel on the presence of active ENaC channels at the apical membrane was then evaluated in an Ussing chamber after permeabilization of the basolateral membrane of alveolar monolayers (Fig. 3). In these experiments, an apical-to-basolateral Na+ gradient was created, and the basolateral membrane was permeabilized by amphotericin B (7.5 µM) (Fig. 3A). Na+ currents, Iamil, sensitive to 1 µM amiloride [ENaC highly selective channel (HSC) currents] and to subsequent addition of 10 µM amiloride [nonselective channel (NSC) currents] were then compared in nontreated and clofilium-treated monolayers. The 1-µM amiloride-sensitive ENaC current was reduced by 57% after clofilium treatment (P = 0.028, n = 5; Fig. 3B), whereas current sensitive to the subsequent addition of 10 µM amiloride was not modified, indicating that clofilium application mainly affected the number of active ENaC channels.


Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. Amiloride-sensitive short-circuit current (Isc) after amphotericin B permeabilization of the basolateral membrane. Alveolar epithelial cells were cultured for 3 days on permeant filters and treated or not for an additional 24 h with clofilium (5 µM, basolateral side; n = 5). The filters were then washed and mounted in an Ussing chamber and bathed with an asymmetric physiological solution (normal physiological solution at the apical side and low-Na+ physiological solution at the basolateral side, where 82% of Na+ was replaced by NMDG-Cl). On stabilization of the current (10 min), the basolateral membrane was permeabilized by perfusion of the lower chamber with the same low-Na+ solution containing 7.5 µM amphotericin B. When the current reached a new plateau, 1 µM and then 10 µM amiloride were added at the apical side. A: mean Isc currents measured on nonpretreated (n = 5) alveolar monolayers. B: amiloride-sensitive Isc (Iamil 1 µM: Isc sensitive to 1 µM; Iamil 1–10 µM: additional decrease in Isc following additional 10 µM amiloride) were then compared in nontreated (n = 5) and clofilium-treated (5 µM, basolateral side for 24 h; n = 5) monolayers. ENaC activity at the apical membrane, estimated by Iamil 1 µM, was significantly reduced by clofilium treatment.

 
Effect of long-term treatment with pinacidil, an activator of KATP channels, on alveolar transepithelial currents. Since it has been shown that prolonged activation of KATP channels increased liquid clearance in human lungs by a mechanism sensitive to amiloride (53), we measured the effect of pinacidil on Na+ transport across alveolar monolayers in an Ussing chamber (Fig. 4A). Basal Isc was significantly augmented by pinacidil treatment (6.6 ± 0.6 and 7.9 ± 0.5 µA/cm2 in the absence and presence of pinacidil, respectively, i.e., a mean difference of 1.3 µA/cm2; P < 0.005). In addition, Iamil increased from 4.3 ± 0.5 µA/cm2 (control condition) to 5.3 ± 0.4 µA/cm2 in 24-h pinacidil-treated monolayers, i.e., a 23% increment (P < 0.02).


Figure 4
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4. Effect of pinacidil, an activator of KATP channels, on transepithelial transport. A: mean Isc values measured in an Ussing chamber on nontreated (control; n = 11) and pinacidil-treated (100 µM, basolateral side, for 24 h; n = 11) intact alveolar monolayers. After stabilization of basal Isc, amiloride (1 µM, apical side) was applied. Forskolin (10 µM, basolateral side) was subsequently added to stimulate cAMP-stimulated Cl currents, inhibited by 5-nitro-2-(3-phenylpropylamino)benzoic acid (NPPB; 200 µM, apical side) at the end of the experiment. B: filters were bathed with an asymmetric physiological solution (normal physiological solution at the basolateral side and low-Cl physiological solution at the apical side, where 77% of Cl was replaced by gluconate). On stabilization of the current (10 min), the basolateral membrane was permeabilized by perfusion of the lower chamber with normal physiological solution containing 7.5 µM amphotericin B. Amiloride (1 µM, apical side), forskolin (10 µM, apical side), and then NPPB (200 µM, apical side) were applied successively. C: cAMP-stimulated, NPPB-sensitive Cl currents (INPPB) of permeabilized alveolar monolayers compared in nontreated and pinacidil-treated (100 µM, basolateral side, 24 h, n = 17) conditions. Mean differences and significance are also indicated.

 
Conversely, forskolin-stimulated and NPPB-sensitive Cl currents were not modified by pinacidil treatment in intact alveolar monolayers (Fig. 4A). However, it must be noted that the kinetics of Cl current stimulation were slow, and the amplitude of the current was low in intact monolayers (Fig. 4A). We then hypothesized that Cl transepithelial current could be rate limited by the basolateral membrane (due to low activity of Na+-K+-2Cl cotransport, for example). To test this hypothesis, the basolateral side of alveolar monolayers was permeabilized and a basolateral-to-apical Cl gradient was created. The addition of forkolin (10 µM; apical side) then induced a faster and higher increase of Isc (an increment of 10.3 ± 1.4 µA/cm2 after 10 min; n = 17; Fig. 4B) in permeabilized monolayers compared with intact monolayers (2.4 µA/cm2 after 50 min; Fig. 4A). This cAMP-stimulated and NPPB-sensitive Cl current was significantly enhanced by pinacidil treatment (mean difference of 2.6 µA/cm2 in the absence and presence of pinacidil; n = 17, P < 0.04) (Fig. 4C).

Regulation of ENaC and CFTR mRNA and Protein Expression by K+ Channel Modulators

Since long-term treatment with K+ channel modulators regulated Na+ and Cl currents, we tested the hypothesis that they also modify ENaC and CFTR expression.

Effect of K+ channel modulators on ENaC expression. Twenty-four-hour treatment with glibenclamide (100 µM, basolateral side) reduced {alpha}-ENaC expression by 29 ± 7% (P = 0.005, n = 8; Fig. 5A) as measured by semiquantitative RT-PCR. This effect seemed specific to basolateral KATP channels since apical treatment with glibenclamide failed to decrease {alpha}-ENaC expression (increase of 1.5 ± 10.9%; NS, n = 8). Clofilium (5 µM), an inhibitor of KvLQT1, induced a smaller reduction of ENaC expression (14.5 ± 5.4%; P = 0.04, n = 6; Fig. 5A). Tram34 (5 µM), an inhibitor of IKCa channels, was ineffective (increase of 6.4 ± 5.4%; NS, n = 5). Glibenclamide, clofilium, and Tram34 in combination (3inh, Fig. 5A) evoked a larger decrease of {alpha}-ENaC expression (49.1 ± 14.7%; P = 0.03, n = 5) compared with the sole application of each inhibitor, suggesting that their effects were additive. In the absence of K+ channel inhibitors, membrane depolarization, after valinomycin (1 µM) treatment in the presence of high-K+ medium (60 mM), also severely reduced {alpha}-ENaC expression (VolKCl, 69.5 ± 7.5%; P = 0.03, n = 4). Basolateral glibenclamide, clofilium, the combination of glibenclamide, clofilium, and Tram34, as well as membrane depolarization also affected beta- and {gamma}-ENaC subunits (Fig. 5, B and C).


Figure 5
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Inhibition of ENaC mRNA expression by K+ channel inhibitors. Alveolar epithelial cells were cultured on permeant filters for 3 days and treated for an additional 24 h on the basolateral side with K+ channel inhibitors, glibenclamide (glib bas; a KATP inhibitor, 100 µM), clofilium (a KvLQT1 inhibitor, 5 µM), Tram34 (an IKCa inhibitor, 5 µM), or a combination of these 3 inhibitors (3inh). The effect of apical glibenclamide was also tested (glib ap, 100 µM). To study the impact of membrane depolarization and increase in intracellular K+ (ValKCl), in the absence of the K+ inhibitor the basolateral side of the monolayers was also treated (24 h) with valinomycin (1 µM) in high-K+ medium (addition of 60 mM KCl in the culture medium). {alpha}- (A), beta- (B), and {gamma}- (C) ENaC mRNA expressions, normalized to beta-actin, are represented as % of control monolayers.

 
The level of {alpha}-ENaC protein, estimated by Western immunoblotting, was reduced by 52.7 ± 6.5% (P = 0.0053, n = 4) and 27.2 ± 9% (P = 0.029, n = 6) after KATP and KvLQT1 channel inhibition by glibenclamide and clofilium, respectively (Fig. 6).


Figure 6
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 6. Inhibition of ENaC protein expression by K+ channel inhibitors. The relative amount of {alpha}-ENaC protein (B) was determined by Western blot analysis using an {alpha}-ENaC antibody (PA1-920, ABR) in alveolar whole cell lysates (50 µg protein) of nontreated monolayers (Ctl) or treated with basolateral glibenclamide (n = 4) or clofilium (n = 6). A representative chemiluminescent reaction is also presented (A). Untransfected Madin-Darby canine kidney cells (MDCK –ENaC, 1 µg protein) and MDCK cells transfected with rat {alpha}-ENaC tagged with the influenza hemagglutinin epitope (MDCK +ENaC, 1 µg protein) served as negative and positive controls. The specificity of the antibody was also verified with a blocking peptide on nontreated alveolar epithelial cell lysates (CtlPep).

 
Consistent with the 23% stimulation of amiloride-sensitive currents by pinacidil, semiquantitative RT-PCR experiments revealed a slight but significant increase of {alpha}-ENaC (17 ± 5%; P = 0.008, n = 11) and {gamma}-ENaC (21.7 ± 9.1%; P = 0.04, n = 10) expression in pinacidil-treated monolayers compared with nontreated monolayers (Fig. 7A). Also, a 32% nonsignificant rise of beta-ENaC expression was recorded. A similar increase of {alpha}-ENaC protein expression was apparent on Western immunoblotting (18.1 ± 7.1% increment in pinacidil-treated monolayers; P = 0.04, n = 7; Fig. 7B).


Figure 7
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7. Stimulation of ENaC expression by pinacidil, an activator of KATP channels. Alveolar epithelial cells were cultured on permeant filters for 3 days and treated for an additional 24 h with pinacidil (100 µM). A: {alpha}-, beta-, and {gamma}-ENaC mRNA expression levels of control and pinacidil-treated monolayers, normalized to beta-actin (n = 10). B: a representative chemiluminescent reaction shows increased {alpha}-ENaC protein expression. The mean relative amount of {alpha}-ENaC protein in cell lysates from pinacidil-treated monolayers was calculated as % of control monolayers (n = 7).

 
Effect of K+ channel modulators on CFTR expression. We observed that glibenclamide, applied on the apical or basolateral side of the monolayers (n = 8), as well as clofilium (n = 6) or Tram34 (n = 9) did not modify CFTR mRNA expression (Fig. 8A). However, combined treatment with basolateral glibenclamide, clofilium, and Tram34 induced a slight but significant decrease of CFTR mRNA (19.7 ± 6.6%; P = 0.04, n = 5; Fig. 8A). Finally, valinomycin and high-K+ treatment, in the absence of the K+ channel inhibitor, also reduced CFTR expression by 73.3 ± 11.1% (P = 0.004, n = 4).


Figure 8
View larger version (16K):
[in this window]
[in a new window]
 
Fig. 8. Inhibition of CFTR mRNA and protein expression by K+ channel inhibitors. Alveolar epithelial cells were cultured on permeant filters for 3 days and treated for an additional 24 h at the basolateral side with K+ channel inhibitors glibenclamide (a KATP inhibitor, 100 µM), clofilium (a KvLQT1 inhibitor, 5 µM), Tram34 (an IKCa inhibitor, 5 µM) or a combination of the 3 (3inh). The impact of membrane depolarization and increase in intracellular K+ (ValKCl), in the absence of the K+ inhibitors, was also tested after treatment at the basolateral side of monolayers with valinomycin (1 µM) in high-K+ medium (addition of 60 mM KCl in the culture medium). A: CFTR mRNA expression, normalized to beta-actin, is represented as % of control monolayers. B: the relative amount of CFTR protein was measured by Western blot analysis with a CFTR antibody (H182, Santa Cruz Biotechnology) in alveolar whole cell lysates (120 µg protein) of nontreated monolayers (control) or monolayers treated with glibenclamide (n = 5) or clofilium (n = 4). A representative chemiluminescent reaction is also presented.

 
Since the decrease of cAMP-stimulated Cl current in the presence of a single K+ channel inhibitor (glibenclamide or clofilium alone) was observed in the absence of CFTR mRNA expression inhibition, we hypothesized that posttranscriptional events could also be involved. Indeed, we found that 24-h treatment with glibenclamide severely reduced CFTR expression (59 ± 17% inhibition; n = 5, P = 0.025; Fig. 8B) measured by Western immunoblotting. Clofilium induced lower inhibition of CFTR expression (29.6 ± 7% inhibition; P = 0.022, n = 4; Fig. 8B).

Effect of pinacidil, an activator of KATP channels, on CFTR expression. CFTR mRNA expression was compared on monolayers treated or not with pinacidil (Fig. 9A). The treatment had a larger effect (46 ± 8% increase; P = 0.0004, n = 11) on CFTR expression than that observed on {alpha}-ENaC mRNA (P = 0.01). This mRNA increment was associated with a 34.1 ± 4.1% elevation of CFTR protein expression in pinacidil-treated monolayers (Fig. 9B; P < 0.0001, n = 5).


Figure 9
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 9. Stimulation of CFTR expression by pinacidil, an activator of KATP channels. A: CFTR mRNA expression levels are compared in control and pinacidil-treated (100 µM, 24 h) alveolar monolayers normalized with beta-actin (n = 11). B: a representative chemiluminescent reaction shows increased CFTR protein expression. The mean relative amount of CFTR protein in cell lysates from pinacidil-treated monolayers is calculated in % of control monolayers (n = 5).

 
Impact of K+ Channel Modulators on Fluid Transport Across Alveolar Epithelial Cell Monolayers

Fluid transport from the apical to the basolateral side of alveolar monolayers (cultured for 4 days at the ALI) was measured for a 24-h period in the presence or absence of K+ channel modulators (Fig. 10). Mean fluid absorption in nontreated monolayers was 0.72 ± 0.07 µl·cm–2·h–1 (n = 12), a value comparable to that reported recently by Fang et al. (Ref. 21; 0.84 µl·cm–2·h–1). Basal fluid transport was reduced by 47.1 ± 5.4% (P < 0.0001, n = 10) after inhibition by amiloride (10 µM, apical side) of Na+ transport through ENaC HSC and NSC channels. Clofilium and glibenclamide elicited an effect similar to that of amiloride on fluid absorption, i.e., 62.5 ± 13.1% (P = 0.017, n = 4) and 38.5 ± 10.1% (P = 0.0123, n = 6) inhibition, respectively. Consistent with the small increase of Iamil by pinacidil, this activator heightened fluid absorption by 21.9 ± 8.3% (P = 0.0331, n = 8).


Figure 10
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 10. Impact of K+ channel modulators on fluid transport across alveolar epithelial monolayers. Fluid absorption (µl·cm–2·h–1) from the apical to the basolateral side of alveolar cell monolayers cultured for 4 days at the air-liquid interface was measured for 24 h, in the presence of amiloride (Amil, 1 µM, apical side; n = 10), glibenclamide (100 µM, basolateral side; n = 6), clofilium (5 µM, basolateral side; n = 4) or pinacidil (100 µM, basolateral side; n = 8) and represented as % of control monolayers.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The results of this study demonstrate the presence of KvLQT1 transcript as well as IKCa and Slo1 transcripts coding for KvLQT1, IKCa, and maxi-KCa channels, respectively, in alveolar epithelial cells. More interestingly, we demonstrated that long-term treatment with modulators of KvLQT1 and KATP channels affected ENaC and CFTR expression (at the mRNA and protein levels). The effect of K+ channel modulators could be mimicked by membrane depolarization, suggesting that changes in membrane potential could be involved in the regulation of ENaC and CFTR expression. Finally, the impact of K+ channel activities on fluid absorption in alveolar epithelia could be explained, at least in part, by a modulation of Na+ and Cl transport.

Molecular Identity and Expression of K+ Channels

In a previous study (31), we identified the molecular identity of the subunits (Kir6.1 and SUR2B) forming KATP channels in alveolar epithelial cells. A similar RT-PCR strategy allowed us to identify KvLQT1, IKCa, and Slo1 (maxi KCa) transcripts. Immunoblotting experiments confirmed the presence of Kir6.1 and KvLQT1 proteins in alveolar monolayers. A band corresponding to the molecular mass of IKCa was also detected, but its specificity could not be confirmed. Conversely, we were not able to detect a signal for Slo1 (maxi-KCa) proteins.

To date, the presence of KvLQT1 and KCa channels has not been clearly demonstrated in alveolar epithelial cells. Indeed, KvLQT1 channels have been reported along airways, in nasal (34, 36), tracheal (23), and bronchial (12, 14) cells; however, a KvLQT1 antisense probe failed to stain alveoli in the mouse lung (14). Our results could not confirm this observation. We not only observed KvLQT1 by PCR but also detected a significant signal by Western blotting with 40 µg of total protein extract, which is relatively low compared with the amount necessary to detect IKCa or CFTR, for example (120 µg). Furthermore, our functional experiments showing the sensitivity of transepithelial currents to short (31) and prolonged (Figs. 2 and 3) application of clofilium, a specific inhibitor of KvLQT1 channels, confirmed the activity of KvLQT1 channels in cultured alveolar epithelial cells. The difference between our data and previously reported data (14) could be explained by a species difference or the low sensitivity of the in situ hybridization technique used.

High-conductance, charybdotoxin-sensitive KCa channels (maxi-KCa or Slo1) were previously found in the alveolar A549 cell line and in nasal cells (28, 29, 52). The intermediate-conductance KCa channel (IKCa channel), which is sensitive to clotrimazole, Tram34, and charybdotoxin, has been also reported in A459 cells as well as in the trachea and bronchi (12, 39, 58, 60). The detection of IKCa and Slo1 transcripts in alveolar cells in primary culture reported in our study is consistent with the presence of these two types of KCa channels in A549 cells. However, the presence of these proteins could not be confirmed in our immunoblot experiments. This absence of signal could be due to the low efficiency of the antibodies or to a low level of expression in control conditions. Further experiments will be needed to determine the difference in PCR and Western blotting data. Contrary to our PCR results, O'Grady and Lee (47) reported in a recent review that neither IKCa nor Slo1 mRNA was detected in alveolar epithelial cells. However, differences in culture conditions, which are known to modulate ion channel expression (10, 24, 31), could explain this discrepancy. Indeed, we observed that Kir6.1 (31) and KvLQT1 (Fig. 1) expression significantly decreased between days 0 and 4, whereas a nonsignificant increase of KCa (IKCa and Slo1) channel expression was recorded (Fig. 1). It should be noted that the freshly isolated cell mix contained ~85% alveolar cells (10). Even if minor contamination with blood cells was not excluded, we estimated that the major part of the nonalveolar cells included in the cell mix was comprised of macrophages (10). IKCa channels, in particular, are expressed in macrophages and blood cells (erythrocytes, lymphocytes, and platelets) (15, 18, 19, 33, 48, 55). Thus contamination with IKCa transcripts of macrophages and blood cells is not excluded in freshly isolated mRNA. However, these contaminating cells are completely absent in cultured alveolar cell monolayers.

The cellular localization of KATP, KvLQT1, and KCa channels has not been clearly defined in lung epithelia. Our acute (31) and chronic (present study) functional experiments suggest a major basolateral localization of KATP, KvLQT1, and KCa channels. Apical localization of these channels could not be completely excluded, but their level of expression was probably very low, since we did not detect any effect of K+ channel inhibitors at the apical membrane. Conversely, chromanol 293B-sensitive Isc (KvLQT1 currents) have been reported (43) at the apical but not at the basolateral membrane in airway serous cells (Calu-3). Consistent with this result, the authors noted apical localization of KvLQT1 channels in immunolocalization experiments. Thus the membrane localization of K+ channels could differ in alveolar and bronchial epithelial cells.

Effect of Long-Term Treatment with K+ Channel Modulators on Transepithelial Currents in Alveolar Epithelial Cells

We recently reported (31) that short-term treatments with KATP, KvLQT1, or KCa inhibitors reduced Na+ and Cl currents in alveolar cell monolayers. On the other hand, even if it has been shown (53) that a KATP opener increased K+ transport and alveolar clearance in human lungs, by a mechanism probably involving ENaC channels, a long-term effect of KATP channel activity on Na+ transport has never been directly demonstrated. We therefore decided to study the impact of long-term modulation of KATP, KvLQT1, and KCa channel activities on Na+ and Cl transepithelial currents. We observed that 24-h treatment with glibenclamide or clofilium reduced basal Isc (inhibition of 60% and 68%, respectively) as well as amiloride-sensitive Na+ currents (inhibition of 74% and 75%) and forskolin-activated Cl currents (inhibition of 41% and 44%) in intact alveolar monolayers. Although IKCa and maxi-KCa inhibitors were efficient on forskolin-activated Cl currents, their inhibitory effects were lower than those of KvLQT1 and KATP inhibitors.

The impact of K+ channel inhibitors on the proportion of active ENaC channels at the apical membrane was then evaluated in basolaterally permeabilized alveolar monolayers. In these conditions, we found that clofilium, an inhibitor of KvLQT1 channels, reduced ENaC HSC currents (sensitive to 1 µM amiloride) by 56%, whereas no effect was observed on NSC currents (sensitive to 10 µM amiloride). These results confirm that K+ channel inhibitors severely decrease ENaC HSC activity and/or expression at the apical membrane.

Since KATP channel activation was shown to stimulate alveolar clearance (53), we tested, in a second step, the effect of a KATP opener on Na+ and Cl transport. Because YM-934, used in that study (53), was not available commercially we chose pinacidil, which is commonly used to activate KATP. We observed that basal Isc as well as amiloride-sensitive currents were stimulated by 24-h treatment with pinacidil in intact alveolar monolayers. This sustained increase in Na+ transport after KATP activation could explain the stimulation of alveolar clearance (Ref. 53 and Fig. 10). Unlike short-term treatment with pinacidil, which elevated forskolin-stimulated Cl current (31), long-term treatment failed to stimulate Cl transport in intact monolayers (Fig. 4A). However, it should be noted in that Figure 4 that the forskolin-stimulated Cl currents increase slowly. A very low amount of active CFTR channels at the apical membrane could explain this observation. Nevertheless, we recently demonstrated (9, 10) the presence of functional CFTR channels in alveolar cells. We then hypothesized that Cl secretion could be rate limited by Cl transporters at the basolateral membrane, since the activity of Na+-K+-2Cl cotransport is relatively weak in alveolar cells (57). To verify whether the basolateral membrane is rate limiting, we decided to permeabilize the basolateral membrane of alveolar monolayers in the presence of a basolateral-to-apical Cl gradient. In these conditions, forskolin induced a rapid and large increase in Cl current (Fig. 4B), confirming our hypothesis. We also found that 24-h treatment with pinacidil induced a slight but significant increment of apical Cl current in permeabilized monolayers (Fig. 4C). This result indicated that the proportion of active CFTR channels at the apical membrane could be upregulated after activation of KATP channels. The effect of pharmacological activation of KvLQT1 and KCa channels was not tested, since there was no specific pharmacological agent activating KvLQT1 channels, and long-term treatment with 1-ethyl-2-benzimidazolinone (1-EBIO), an activator of IKCa channels, induced a significant decrease in Rte.

Impact of K+ Channel Activity on ENaC and CFTR Expression

Several hypotheses could explain the coupling of K+ channel activity with Na+ and Cl transport. After short-term modulation of K+ channels, the changes in electrochemical gradients would predictably affect the flow of Na+ and Cl ions. However, on prolonged treatment with K+ channel modulators, the observed modulation of Na+ and Cl transport could be consecutive to multiple cellular events inducing sustained changes in ion channel activities as well as the modification of a number of expressed channels. We then explored the possibility that K+ channel activity could influence ENaC and/or CFTR expression at mRNA and protein levels.

We noted that inhibitors of KATP or KvLQT1 channels used alone or in combination significantly reduced the mRNA expression of {alpha}-, beta-, and {gamma}-ENaC subunits. It must be mentioned that the effects of KATP, KvLQT1, and IKCa inhibitors were additive. In addition, the inhibitory influence of K+ channel blockers on ENaC expression could be mimicked by membrane depolarization and an increase in intracellular K+ concentration ([K+]i). In contrast, pinacidil, an activator of KATP channels, enhanced ENaC expression. Since the cellular mRNA level depends on gene transcription as well as mRNA stability, it would be necessary in the future to clarify whether K+ channel activity directly or indirectly modifies ENaC promoter activity or rates of mRNA degradation. KATP and KvLQT1 inhibitors and activators also regulated ENaC protein expression, which is consistent with the observed changes in Na+ transport.

CFTR mRNA expression was also reduced by K+ channel inhibitors applied in combination or by membrane depolarization. However, KATP and KvLQT1 inhibitors were ineffective when applied alone, whereas they efficiently reduced CFTR protein expression. Our results indicate that transcriptional as well as posttranscriptional regulatory mechanisms could be involved in the control of CFTR expression after changes in K+ channel activities.

We also found that pinacidil stimulated CFTR mRNA and protein expression. However, as detailed below, this increase in CFTR expression was coupled to an elevation of cAMP-stimulated Cl currents in basolaterally permeabilized monolayers only. As detailed below, we believe that such results can be explained, at least in part, by the low efficiency of basolateral Cl transporters, such as the Na+-K+-2Cl cotransporter, which probably rate limited Cl secretion in intact monolayers.

Actually, the intracellular mechanisms responsible for both transcriptional and posttranscriptional regulation of ENaC and CFTR expression are not well defined. The aim of this study was not to determine the regulatory mechanisms of ENaC and CFTR expression by K+ channel modulators, but several hypotheses merit exploration in the future. Different cellular signals could be implicated, including changes in membrane potential. We demonstrated, for example, that membrane depolarization after valinomycin application in the presence of high-K+ medium reduced ENaC and CFTR expression. The additive inhibitory effect of K+ channels modulators observed in our study also confirmed that the targets of K+ channel blockers are the K+ channels directly, their simultaneous action probably producing larger membrane depolarization. However, if membrane depolarization after acute application of K+ blockers is easy to explain, it is not certain whether this change in membrane potential could be sustained by chronic exposure. Nevertheless, a sustained decrease of membrane potential has already been reported in arterial smooth muscle from hypertensive animals, which exhibited reduced voltage-dependent K+ current together with membrane depolarization and elevated intracellular Ca2+ concentration ([Ca2+]i) compared with normotensive rats (59).

Such changes in membrane potential could have several consequences on intracellular ion concentrations, which could control ion channel expression. For example, an increase in [Ca2+]i coupled to membrane depolarization has been associated with the activation of transcription factors (41, 59). In addition, intracellular calcium has been demonstrated to regulate both CFTR (1) and ENaC (50) expression. On the other hand, it has been proposed that intracellular concentrations of monovalent ions could also act as second messengers. [K+]i, for example, has been shown to regulate protein phosphatase A2 activity, which is responsible for dephosphorylation and deactivation of CFTR in the sweat ducts (51). This cation is also involved in protein synthesis in several cell types (11, 30, 40, 49). In addition to changes in [K+]i, membrane depolarization could also be responsible for intracellular Na+ or Cl concentration changes, which have been demonstrated, for example, to regulate {alpha}-ENaC expression (46).

Regulation of Fluid Transport by K+ Channel Modulators

Since K+ channel modulators affected Na+ and Cl transport, we decided to test their impact on fluid absorption across alveolar monolayers. We first observed that the basal level of fluid reabsorption across alveolar monolayers in our study (0.72 µl·cm–2·h–1) was close to that reported recently by Fang et al. (21) (0.84 µl·cm–2·h–1). In addition, we confirmed that ENaC inhibition with amiloride reduced fluid absorption by ~50%. This result is consistent with an involvement of Na+ transport in fluid absorption. We also demonstrated that KvLQT1 and KATP channel activity was necessary for fluid absorption, since clofilium and glibenclamide reduced it by 62% and 39%, respectively. This finding indicated that K+ channel activities, probably through their control of ENaC and/or CFTR channel activity and expression that regulate Na+ and Cl transport, also contribute to maintain fluid clearance in reabsorbing epithelia. However, an impact of changes in K+ channel activity on other transport mechanisms, potentially involved in fluid transport, is not excluded. Finally, pinacidil significantly enhanced fluid absorption. It must be noted, however, that the level of stimulation of Na+ and fluid transport was relatively low. It would be interesting to apply KATP and KvLQT1 channel activators in combination to potentate their activating effects. Unfortunately, KvLQT1 channels lacked specific openers.

In summary, our study demonstrates that freshly isolated and cultured alveolar cell monolayers expressed KATP, KvLQT1, IKCa and Slo1 K+ channels. We observed that long-term modulation of K+ channel activities exerted sustained control in Na+, Cl, and fluid transport, which involves the regulation of {alpha}-, beta-, and {gamma}-ENaC as well as CFTR expression.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the CHUM Research Centre Foundation and the Natural Sciences and Engineering Research Council of Canada (Grant 312177-05). E. Brochiero was the recipient of a scholarship from Fonds de la recherche en santé du Québec (FRSQ).


    ACKNOWLEDGMENTS
 
We thank Dr. M.A. Matthay for his protocol and kind advice on the fluid transport experiments. We also acknowledge the editorial assistance of Ovid Da Silva, Research Support Office, Research Centre, CHUM.


    FOOTNOTES
 

Address for reprint requests and other correspondence: E. Brochiero, Centre de recherche, CHUM-Hôtel-Dieu, 3850 St-Urbain, Montreal, QC H2W 1T7, Canada (e-mail: emmanuelle.brochiero{at}umontreal.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bargon J, Trapnell BC, Chu CS, Rosenthal ER, Yoshimura K, Guggino WB, Dalemans W, Pavirani A, Lecocq JP, and Crystal RG. Down-regulation of cystic fibrosis transmembrane regulator gene expression by agents that modulate intracellular calcium. Mol Cell Biol 12: 1872–1878, 1992.[Abstract/Free Full Text]
  2. Berthiaume Y. Mechanisms of edema clearance. In: Pulmonary Edema, edited by Weir EK and Reeves JT. Mount Kisco, NY: Futura, p. 7–94, 1998.
  3. Berthiaume Y, Broaddus VC, Gropper MA, Tanita T, and Matthay MA. Alveolar liquid and protein clearance from normal dog lungs. J Appl Physiol 65: 585–593, 1988.[Abstract/Free Full Text]
  4. Berthiaume Y, Folkesson HG, and Matthay MA. Lung edema clearance: 20 years of progress: alveolar edema fluid clearance in the injured lung. J Appl Physiol 93: 2207–2213, 2002.[Abstract/Free Full Text]
  5. Berthiaume Y, Lesur O, and Dagenais A. Treatment of adult respiratory distress syndrome: plea for rescue therapy of the alveolar epithelium. Thorax 54: 150–160, 1999.[Free Full Text]
  6. Berthiaume Y, Staub NC, and Matthay MA. Beta-adrenergic agonists increase lung liquid clearance in anesthetized sheep. J Clin Invest 79: 335–343, 1987.[Web of Science][Medline]
  7. Boucher RC. Human airway ion transport: part one. Am J Respir Crit Care Med 150: 271–281, 1994.[Web of Science][Medline]
  8. Boucher RC. Human airway ion transport: part two. Am J Respir Crit Care Med 150: 581–593, 1994.[Web of Science][Medline]
  9. Brochiero E, Dagenais A, Berthiaume Y, and Grygorczyk R. Functional CFTR Cl channels in adult alveolar epithelial cells (Abstract). Pediatr Pulmonol 25, Suppl: 206, 2003.
  10. Brochiero E, Dagenais A, Privé A, Berthiaume Y, and Grygorczyk R. Evidence of functional CFTR Cl channels in adult alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 287: L382–L392, 2004.[Abstract/Free Full Text]
  11. Cahn F and Lubin M. Inhibition of elongation steps of protein synthesis at reduced potassium concentrations in reticulocytes and reticulocyte lysate. J Biol Chem 253: 7798–7803, 1978.[Abstract/Free Full Text]
  12. Cowley E and Linsdell P. Characterization of basolateral K+ channels underlying anion secretion in human airway cell line Calu-3. J Physiol 538: 747–757, 2002.[Abstract/Free Full Text]
  13. Dagenais A, Fréchette R, Yamagata Y, Yamagata T, Carmel JF, Clermont ME, Brochiero E, Massé C, and Berthiaume Y. Downregulation of ENaC activity and expression by TNF-{alpha} in alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 286: L301–L311, 2004.[Abstract/Free Full Text]
  14. Demolombe S, Franco D, de Boer P, Kuperschmidt S, Roden D, Pereon Y, Jarry A, Moorman AF, and Escande D. Differential expression of KvLQT1 and its regulator IsK in mouse epithelia. Am J Physiol Cell Physiol 280: C359–C372, 2001.[Abstract/Free Full Text]
  15. de Silva HA, Carver JG, and Aronson JK. Pharmacological evidence of calcium-activated and voltage-gated potassium channels in human platelets. Clin Sci (Lond) 93: 249–255, 1997.[Medline]
  16. Devor DC, Singh AK, Frizzell RA, and Bridges RJ. Modulation of Cl secretion by benzimidazolones. I. Direct activation of a Ca2+-dependent K+ channel. Am J Physiol Lung Cell Mol Physiol 271: L775–L784, 1996.[Abstract/Free Full Text]
  17. Dobbs LG, Gonzalez R, and Williams MC. An improved method for isolating type II cells in high yield and purity. Am Rev Respir Dis 134: 141–145, 1986.[Web of Science][Medline]
  18. Dunn PM. The action of blocking agents applied to the inner face of Ca2+-activated K+ channels from human erythrocytes. J Membr Biol 165: 133–143, 1998.[CrossRef][Web of Science][Medline]
  19. Ehring GR, Kerschbaum HH, Eder C, Neben AL, Fanger CM, Khoury RM, Negulescu PA, and Cahalan MD. A nongenomic mechanism for progesterone-mediated immunosuppression: inhibition of K+ channels, Ca2+ signaling, and gene expression in T lymphocytes. J Exp Med 188: 1593–1602, 1998.[Abstract/Free Full Text]
  20. Fang X, Fukuda N, Barbry P, Sartory C, Verkman AS, and Matthay MA. Novel role for CFTR in fluid absorption from distal airspaces of the lung. J Gen Physiol 119: 199–208, 2002.[Abstract/Free Full Text]
  21. Fang X, Song Y, Zemans R, Hirsch J, and Matthay MA. Fluid transport across cultured rat alveolar epithelial cells: a novel in vitro system. Am J Physiol Lung Cell Mol Physiol 287: L104–L110, 2004.[Abstract/Free Full Text]
  22. Feng ZP, Clark RB, and Berthiaume Y. Identification of non-selective cation channels in cultured adult rat alveolar type II cells. Am J Respir Cell Mol Biol 9: 248–254, 1993.[Web of Science][Medline]
  23. Grahammer F, Warth R, Barhanin J, Bleich M, and Hug MJ. The small conductance K+ channel, KCNQ1. Expression, function, and subunit composition in murine trachea. J Biol Chem 276: 42268–42275, 2001.[Abstract/Free Full Text]
  24. Jain L, Chen XJ, Ramosevac S, Brown LA, and Eaton DC. Expression of highly selective sodium channels in alveolar type II cells is determined by culture conditions. Am J Physiol Lung Cell Mol Physiol 280: L646–L658, 2001.[Abstract/Free Full Text]
  25. Jayr C, Garat C, Meignan M, Pittet JF, Zelter M, and Matthay MA. Alveolar liquid and protein clearance in anesthetized ventilated rats. J Appl Physiol 76: 2636–2642, 1994.[Abstract/Free Full Text]
  26. Johnson MD, Widdicombe JH, Allen L, Barbry P, and Dobbs LG. Alveolar epithelial type I cells contain transport proteins and transport sodium, supporting an active role for type I cells in regulation of lung liquid homeostasis. Proc Natl Acad Sci USA 99: 1966–1971, 2002.[Abstract/Free Full Text]
  27. Kunzelmann K, Hubner M, Schreiber R, Levy-Holzman R, Garty H, Bleich M, Warth R, Slavik M, von Hahn T, and Greger R. Cloning and function of the rat colonic epithelial K+ channel KVLQT1. J Membr Biol 179: 155–164, 2001.[CrossRef][Web of Science][Medline]
  28. Kunzelmann K, Pavenstadt H, Beck C, Unal O, Emmrich P, Arndt HJ, and Greger R. Characterization of potassium channels in respiratory cells. I. General properties. Pflügers Arch 414: 291–296, 1989.[CrossRef][Web of Science][Medline]
  29. Kunzelmann K, Pavenstadt H, and Greger R. Characterization of potassium channels in respiratory cells. II. Inhibitors and regulation. Pflügers Arch 414: 297–303, 1989.[CrossRef][Web of Science][Medline]
  30. Ledbetter ML and Lubin M. Control of protein synthesis in human fibroblasts by intracellular potassium. Exp Cell Res 105: 223–236, 1977.[CrossRef][Web of Science][Medline]
  31. Leroy C, Dagenais A, Berthiaume Y, and Brochiero E. Molecular identity and function in transepithelial transport of KATP channels in alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 286: L1027–L1037, 2004.[Abstract/Free Full Text]
  32. Liao T, Wang L, Troutman Halm S, Lu L, Fyffe REW, and Halm DR. K+ channel KvLQT1 located in the basolateral membrane of distal colonic epithelium is not essential for activating Cl secretion. Am J Physiol Cell Physiol 289: C564–C575, 2005.[Abstract/Free Full Text]
  33. Logsdon NJ, Kang J, Togo JA, Christian EP, and Aiyar J. A novel gene, hKCa4, encodes the calcium-activated potassium channel in human T lymphocytes. J Biol Chem 272: 32723–32726, 1997.[Abstract/Free Full Text]
  34. MacVinish LJ, Hickman ME, Mufti DA, Durrington HJ, and Cuthbert AW. Importance of basolateral K+ conductance in maintaining Cl secretion in murine nasal and colonic epithelia. J Physiol 510: 237–247, 1998.[Abstract/Free Full Text]
  35. Mall M, Gonska T, Thomas J, Shreiber R, Seydewitz HH, Kuehr J, Brandis M, and Kunzelmann K. Modulation of Ca2+-activated Cl secretion by basolateral K+ channels in human normal and cystic fibrosis airway epithelia. Pediatr Res 53: 608–618, 2003.[CrossRef][Web of Science][Medline]
  36. Mall M, Wissner A, Schreiber R, Kuehr J, Seydewitz HH, Brandis M, Greger R, and Kunzelmann K. Role of KVLQT1 in cyclic adenosine monophosphate-mediated Cl secretion in human airway epithelia. Am J Respir Cell Mol Biol 23: 283–289, 2000.[Abstract/Free Full Text]
  37. Matalon S and O'Brodovich H. Sodium channels in alveolar epithelial cells: molecular characterization, biophysical properties, and physiological significance. Annu Rev Physiol 61: 627–661, 1999.[CrossRef][Web of Science][Medline]
  38. Matthay MA, Folkesson HG, and Verkmann AS. Salt and water transport across alveolar and distal airway epithelia in adult lung. Am J Physiol Lung Cell Mol Physiol 270: L487–L503, 1996.[Abstract/Free Full Text]
  39. McCann JD, Matsuda J, Garcia M, Kaczorowski G, and Welsh MJ. Basolateral K+ channels in airway epithelia. I. Regulation by Ca2+ and block by charybdotoxin. Am J Physiol Lung Cell Mol Physiol 258: L334–L342, 1990.[Abstract/Free Full Text]
  40. Meeker GL. Intracellular potassium requirement for protein synthesis and mitotic apparatus formation in sea urchin eggs. Exp Cell Res 63: 165–170, 1970.[CrossRef][Web of Science][Medline]
  41. Millhorn DE, Raymond R, Conforti L, Zhu W, Beitner-Johnson D, Filisko T, Genter MB, Kobayashi S, and Peng M. Regulation of gene expression for tyrosine hydroxylase in oxygen sensitive cells by hypoxia. Kidney Int 51: 527–535, 1997.[Web of Science][Medline]
  42. Minakata Y, Suzuki S, Grygorczyk C, Dagenais A, and Berthiaume Y. Impact of beta-adrenergic agonist on Na+ channel and Na+-K+-ATPase expression in alveolar type II cells. Am J Physiol Lung Cell Mol Physiol 275: L414–L422, 1998.[Abstract/Free Full Text]
  43. Moser SL, Davis KA, and Cowley EA. Contribution of potassium channels to anion secretion in human airway epithelial cell line Calu-3 (Abstract). Pediatr Pulmonol 28, Suppl: 214, 2005.
  44. Mulberg AE, Wiedner EB, Bao X, Marshall J, Jefferson DM, and Altschler SM. Cystic fibrosis transmembrane conductance regulator protein expression in brain. Neuroreport 5: 1684–1688, 1994.[CrossRef][Web of Science][Medline]
  45. Neylon CB, Lang RJ, Fu Y, Bobik A, and Reinhart PH. Molecular cloning and characterization of the intermediate-conductance Ca2+-activated K+ channel in vascular smooth muscle: relationship between KCa channel diversity and smooth muscle cell function. Circ Res 85: E33–E43, 1999.
  46. Niisato N, Eaton D, and Marunaka Y. Involvement of cytosolic Cl in osmoregulation of {alpha}-ENaC gene expression. Am J Physiol Renal Physiol 287: F932–F939, 2004.[Abstract/Free Full Text]
  47. O'Grady S and Lee SY. Chloride and potassium channel function in alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 284: L689–L700, 2003.[Abstract/Free Full Text]
  48. Partiseti M, Choquet D, Diu A, and Korn H. Differential regulation of voltage- and calcium-activated potassium channels in human B lymphocytes. J Immunol 148: 3361–3368, 1992.[Abstract]
  49. Pollack M and Fisher HW. Dissociation of ribonucleic acid and protein synthesis in mammalian cells deprived of potassium. Arch Biochem Biophys 172: 189–190, 1976.[Medline]
  50. Rao US, Baker JM, Pluznick JL, and Balachandran P. Role of intracellular Ca2+ in the expression of the amiloride-sensitive epithelial sodium channel. Cell Calcium 35: 21–28, 2004.[CrossRef][Web of Science][Medline]
  51. Reddy M and Quinton PM. Cytosolic potassium signals PP-2A deactivation of CFTR in absorptive epithelial cells (Abstract). Pediatr Pulmonol 27, Suppl: 196, 2004.
  52. Ridge FP, Duszyk M, and French AS. A large conductance, Ca2+-activated K+ channel in a human lung epithelial cell line (A549). Biochim Biophys Acta 1327: 249–258, 1997.[Medline]
  53. Sakuma T, Takahashi K, Ohya N, Nakada T, and Matthay MA. Effects of ATP-sensitive potassium channel opener on potassium transport and alveolar fluid clearance in the resected human lung. Pharmacol Toxicol 83: 16–22, 1998.[Web of Science][Medline]
  54. Sampson LJ, Hayabuchi Y, Standen NB, and Dart C. Caveolae localize protein kinase A signaling to arterial ATP-sensitive potassium channels. Circ Res 95: 1012–1018, 2004.[Abstract/Free Full Text]
  55. Saraiva RM, Masuda MO, and Oliveira-Castro GM. Outward potassium current oscillations in macrophage polykaryons: extracellular calcium entry and calcium-induced calcium release. Braz J Med Biol Res 30: 1349–1357, 1997.[Web of Science][Medline]
  56. Singh AK, Devor DC, Gerlach AC, Gondor M, Pilewski JM, and Bridges RJ. Stimulation of Cl secretion by chlorzoxazone. J Pharmacol Exp Ther 292: 778–787, 2000.[Abstract/Free Full Text]
  57. Skriabin G, Orlov S, Massé C, and Berthiaume Y. Phloretin inhibits Na+ and K+ uptake in cultured alveolar type II cells by reduction of cellular ATP content. Exp Lung Res 26: 319–333, 2000.[CrossRef][Web of Science][Medline]
  58. Szkotak AJ, Ng AM, Sawicka J, Baldwin SA, Man SF, Cass CE, Young JD, and Duszyk M. Regulation of K+ current in human airway epithelial cells by exogenous and autocrine adenosine. Am J Physiol Cell Physiol 281: C1991–C2002, 2001.[Abstract/Free Full Text]
  59. Wellman GC, Cartin L, Eckman DM, Stevenson AS, Saundry CM, Lederer WJ, and Nelson MT. Membrane depolarization, elevated Ca2+ entry, and gene expression in cerebral arteries of hypertensive rats. Am J Physiol Heart Circ Physiol 281: H2559–H2567, 2001.[Abstract/Free Full Text]
  60. Welsh MJ and McCann JD. Intracellular calcium regulates basolateral potassium channels in a chloride-secreting epithelium. Proc Natl Acad Sci USA 82: 8823–8826, 1985.[Abstract/Free Full Text]
  61. Yamagata T, Yamagata Y, Massé C, Tessier MC, Brochiero E, Dagenais A, and Berthiaume Y. Modulation of Na+ transport and ENaC expression by kinase C in rat alveolar epithelial cells. Can J Physiol Pharmacol 83: 977–987, 2005.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. Yang, L. Su, Y. Wang, and L. Liu
UTP regulation of ion transport in alveolar epithelial cells involves distinct mechanisms
Am J Physiol Lung Cell Mol Physiol, September 1, 2009; 297(3): L439 - L454.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
O. Bardou, N. T. N. Trinh, and E. Brochiero
Molecular diversity and function of K+ channels in airway and alveolar epithelial cells
Am J Physiol Lung Cell Mol Physiol, February 1, 2009; 296(2): L145 - L155.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. T. N. Trinh, A. Prive, E. Maille, J. Noel, and E. Brochiero
EGF and K+ channel activity control normal and cystic fibrosis bronchial epithelia repair
Am J Physiol Lung Cell Mol Physiol, November 1, 2008; 295(5): L866 - L880.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
X. Bai, J. Ma, Z. Pan, Y.-H. Song, S. Freyberg, Y. Yan, D. Vykoukal, and E. Alt
Electrophysiological properties of human adipose tissue-derived stem cells
Am J Physiol Cell Physiol, November 1, 2007; 293(5): C1539 - C1550.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. T. N. Trinh, A. Prive, L. Kheir, J.-C. Bourret, T. Hijazi, M. G. Amraei, J. Noel, and E. Brochiero
Involvement of KATP and KvLQT1 K+ channels in EGF-stimulated alveolar epithelial cell repair processes
Am J Physiol Lung Cell Mol Physiol, October 1, 2007; 293(4): L870 - L882.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/6/L1207    most recent
00376.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leroy, C.
Right arrow Articles by Brochiero, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leroy, C.
Right arrow Articles by Brochiero, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.