AJP - Lung Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 292: L114-L124, 2007. First published August 4, 2006; doi:10.1152/ajplung.00257.2005 Free Article
1040-0605/07 $8.00
This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/L114    most recent
00257.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siddiqui, S. S.
Right arrow Articles by Malik, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siddiqui, S. S.
Right arrow Articles by Malik, A. B.

p38 MAPK activation coupled to endocytosis is a determinant of endothelial monolayer integrity

Shahid S. Siddiqui, Zeba K. Siddiqui, Shahab Uddin, Richard D. Minshall, and Asrar B. Malik

Department of Pharmacology and Center for Lung and Vascular Biology, University of Illinois College of Medicine, Chicago, Illinois

Submitted 14 June 2005 ; accepted in final form 28 July 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We show in rat lung microvessel endothelial cells (RLMVEC) that endocytosis is a critical determinant of activation of mitogen-activated protein kinase (MAPK) and thereby regulates endothelial monolayer integrity. In RLMVEC grown in serum-free medium, we observed that albumin supplementation induced the phosphorylation of p38 MAPK within 30 min, which persisted for up to 2 h. Engagement of the endocytic machinery regulated the activation of p38 MAPK that contributed to endothelial cell proliferation and reduction of apoptosis. We also observed an interaction between the caveolar protein caveolin-1 and p38 MAPK with reciprocal coimmunoprecipitation assays and colocalization using double-label immunofluorescence staining. Knockdown of caveolin-1 expression with small interfering RNA significantly reduced endocytosis and activation of p38 MAPK and interfered with the ability of endothelial cells to form a confluent monolayer. Thus caveolae-mediated endocytosis and concomitant activation of p38 MAPK may help to maintain endothelial monolayer integrity by signaling proliferation and survival of endothelial cells.

stress mitogen-activated protein kinase; caveolin-1; transforming growth factor-beta signaling; cell proliferation


THE BASIC FUNCTION of endothelial cells lining the vessel wall is their ability to form a continuous confluent monolayer and serve as a semipermeable barrier (11). Endothelial cells also have a large number of vesicles comprising 15–20% of cell volume (20). There is a constitutive process of endocytosis mediated by the internalization of the plasmalemmal invaginations, caveolae (20). Although caveolar internalization is responsible for transcytosis of albumin and other plasma proteins across the endothelial barrier, endocytosis may also have key functions in cell signaling (4, 5, 7, 25). In the present study, we investigated the possibility that caveolae-mediated endocytosis is a determinant of endothelial cell proliferation and cell survival and thus regulates the integrity of the endothelial monolayer.

We have shown (24) that albumin activation of transforming growth factor (TGF)-beta receptor (TbetaR)II stimulates endocytosis in rat lung microvessel endothelial cell (RLMVEC) monolayers. TGF-beta signaling is triggered by its binding to a heteromeric complex consisting of two transmembrane serine/threonine kinase receptors, type I and type II (TbetaRI and TbetaRII) (8, 16, 26). In serum-deprived RLMVEC, we observed that supplementation with albumin induced activation of caveolae-mediated endocytosis (11) and subsequent TbetaRII signaling that resulted in Smad2 phosphorylation and Smad4 translocation (21, 24). These studies did not examine the downstream consequences of activation of endocytosis in promoting endothelial cell proliferation and survival.

Mammalian p38 mitogen-activated protein kinase (MAPK) is activated in response to extracellular stimuli such as UV light, heat, osmotic shock, inflammatory cytokines (TNF-{alpha} and IL-1beta), and growth factors (e.g., colony-stimulating factor-1) (28). TGF-beta, through activation of TGF-beta-activated protein kinase-1-binding protein mediates p38 MAPK activation, thus linking TGF-beta signaling to p38 MAPK activation (23, 27). In the present study, we showed that induction of caveolae-mediated endocytosis in endothelial cells resulted in the activation of p38 MAPK enzyme activity and phosphorylation of p38 MAPK. The activation of p38 MAPK activation induced endothelial cell proliferation and reduced apoptosis. Moreover, depletion of caveolin-1 expression with small interfering RNA (siRNA) significantly reduced endocytosis as well as activation of p38 MAPK and resulted in the impairment of proliferation and apoptosis responses in endothelial cells. These results point to a crucial role of p38 MAPK activation occurring as the result of caveolae-mediated endocytosis in regulating endothelial cell proliferation and survival and thereby controlling the integrity of the endothelial monolayer.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. Polyclonal antibodies directed against caveolin-1, p38 MAPK, and the phosphorylated form of p38 MAPK (p38-P MAPK), fluorescein isothiocyanate (FITC)- and Texas Red isothiocyanate (TRITC)-conjugated polyclonal goat and donkey antibodies against mouse and rabbit IgG, goat anti-mouse IgG, mouse IgG, and rabbit preimmune serum IgG were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit anti-phospho-activating transcription factor (ATF)-2 antibody was purchased from Cell Signaling (Beverly, MA). RLMVEC (VEC Technologies, Rensselaer, NY) were cultured as described previously (11). Bovine serum albumin fraction V (BSA; 99% pure, endotoxin free), FITC-labeled BSA, TRITC-BSA, and bovine IgG were purchased from Sigma (St. Louis, MO). DMEM, PBS, fetal bovine serum (FBS), and antibiotics (ampicillin, penicillin) were purchased from Biowhittaker (Walkersville, MD). Sepharose IgG-conjugated beads were purchased from Amersham Pharmacia (Piscataway, NJ). Carboxyfluorescein diacetate succinimidyl ester (CFSE), an intracellular dye to monitor cell proliferation, was a gift of Dr. Ronald Hoffman, University of Illinois at Chicago Cancer Center. Experiments were performed at least three times, and in specific instances representative data are reported.

Fluorescence measurements. Fluorescence measurements in live cells (RLMVEC) were performed as described previously (24) with a Nikon Eclipse 800 fluorescence microscope equipped with differential interference contrast (DIC). Fluorescence and DIC images were acquired with a charge-coupled device camera (Hamamatsu Photonics, Hamamatsu, Japan) and processed with Metamorph imaging analysis software (Universal Imaging, West Chester PA).

Endocytosis assay. Endocytosis was assayed by the uptake of albumin with FITC-BSA or TRITC-BSA as the tracer (24). In RLMVEC treated with the MAPK p38 inhibitor SB-203580 (6, 7, 25) (Calbiochem, San Diego, CA), the drug (1–20 µM) was incubated in increasing concentrations in confluent cell monolayers for 4 h at 37°C. Care was taken to avoid exposure to light during the uptake assay. Endocytosis following caveolin-1 siRNA treatment was similarly assayed.

TUNEL assay. Terminal deoxynucleotidyltransferase nick end labeling (TUNEL) was used to determine the number of cells undergoing apoptosis. RLMVEC monolayers were fixed with 4% formaldehyde in PBS for 30 min and washed with chilled PBS. Cells were treated with terminal transferase together with FITC-dATP and dATP. In controls, no terminal transferase was included. Cells were observed with a FITC filter set and a Nikon E600 fluorescence microscope. Apoptotic nuclei looked fragmented and stained intensely with fluorescein-conjugated substrate. Nonapoptotic cells showed large vesicular nuclei and had regular chromatin staining. Cells (100) were randomly selected in a given microscopic field, and the percentage of apoptotic cells was determined. At least five such microscopic fields were selected from each experimental condition.

Apoptosis and cell survival assay. Cells undergoing apoptosis were stained with the nuclear dye 4',6'-diamidino-2-phenylindole (DAPI) and counted in UV images acquired with a Nikon E600 microscope. Apoptotic cells showed nuclei that appeared fragmented and stained brightly with DAPI, whereas normal live cells had nuclei with rounded vesicular morphology that stained lightly with DAPI and showed finely stippled chromosomal threads. In each randomly chosen field of RLMVEC, 100–200 cells per field were counted. For the cell survival index, a similar assessment using DAPI staining of live cells was used to determine the fraction of live cells. Three experiments were conducted in each condition, and the results are reported as means ± SD.

Fluorescence-activated cell sorting analysis of apoptosis. RLMVEC were grown in serum-free or DMEM medium supplemented with albumin and various treatments such as taxol, TGF-beta, p38 inhibitor SB-20385, or caveolin-1 siRNA as indicated. After treatment, cells were exposed to trypsin, washed twice in 2% FBS in PBS (pH 7.4), and filtered through a 60-µm nylon mesh. Cells were stained with Vybrant Apoptosis Assay Kit no. 5 (Molecular Probes, Eugene, OR), and fluorescence-activated cell sorting (FACS) analysis was performed. Populations of viable, apoptotic, and dead cells were easily distinguished by flow cytometry using the 488-nm line of the Ar laser. Dead cells were labeled with propidium iodide (PI), and the blue fluorescent Hoechst 33342 stain labeled condensed chromatin of apoptotic cells more brightly than the chromatin of normal cells. Before data acquisition, 1 µl of PI per milliliter of cell suspension was added on ice, followed by 1 µl of Hoechst 33342. Cells were incubated on ice for 2 min, and PI and Hoechst 33342 fluorescence was read at 575 and 480 nm, respectively. For each experimental condition three independent experiments were conducted, and the data are presented as means ± SD.

Immunostaining and confocal microscopy. RLMVEC were fixed with 4% paraformaldehyde and stained with mouse anti-caveolin-1 monoclonal antibody and polyclonal rabbit anti-p38-P MAPK antibody as described previously (24). Cells were washed with PBS-Triton (0.1%) and labeled with Alexa 488 or Alexa 594 secondary antibodies (1:200 in PBS) for 1 h at room temperature, washed, and mounted with Prolong antifade mounting medium (Molecular Probes). Images were collected with a Zeiss LSM 510 META confocal microscope with the pinhole set to achieve 1 Airy unit.

Lysate and membrane-enriched fraction isolation from RLMVEC. Detergent-soluble membrane fractions were isolated from RLMVEC as described previously (24).

SDS-PAGE and immunoblotting. RLMVEC were grown to confluence in albumin-free or albumin-supplemented medium in 10-cm or six-well dishes. SDS-PAGE, immunoblotting, and signal detection were performed as described previously (24).

Inhibition of p38 MAPK. RLMVEC were incubated for 4 or 8 h with the p38 MAPK inhibitor SB-203580 (10–20 µM). Confluent cells were grown either in the absence of serum or in medium supplemented with albumin. Hyperosmotic shock was provided with 0.5 M NaCl.

p38 MAPK assay. RLMVEC were grown to confluence in 10-cm culture plates in DMEM supplemented with 10% FBS and antibiotics and then grown for 24 h in either serum-free or FBS-supplemented medium for 24 h. The p38 MAPK assay was carried out as described previously (1). Briefly, cells were incubated in the presence or absence of albumin or FBS for 1 h or with 0.5 M NaCl for 30 min at 37°C. Cells were then lysed as described previously (24). Cell lysate was immunoprecipitated with rabbit anti-p38 polyclonal antibody together with protein G-Sepharose. The immunocomplex was subsequently washed with phosphorylation lysis buffer containing 0.1% Triton X-100 and twice with kinase buffer [mM: 25 HEPES, 25 MgCl2, 25 {alpha}-glycerophosphate, 0.5 ATP, 2 dithiothreitol (DTT), and 0.1 Na3VO4, with 20 µg of glutathione S-transferase-ATF-2 fusion protein] for 20 min at 30°C. Proteins were analyzed by SDS-PAGE, and the phosphorylated protein substrate was detected by immunoblotting with anti-phospho-ATF-2 antibody diluted 1:100 in PBS. The blot from the kinase assay was stripped and probed with an antibody against p38 MAPK to normalize protein loading. We similarly studied the induction of p38 MAPK phosphorylation after treatment of RLMVEC with TGF-beta. Cells were incubated with the optimum dose of 2 ng/ml TGF-beta (R&D Systems, Minneapolis, MN) for different time periods. Cell lysates were prepared, and protein fractions were immunoblotted with antibodies against p38-P MAPK. The blots were stripped and reblotted with rabbit anti-p38 MAPK as described above.

CFSE dye dilution assay and FACS analysis. RLMVEC were grown to confluence in 10-cm dishes in DMEM supplemented with 10% FBS and antibiotics. Confluent monolayers were incubated in serum-free medium for 24 h. In one group 100 µg/ml albumin-supplemented DMEM was used, whereas in the other group RLMVEC were maintained in albumin-free medium. Cells were detached with trypsin, suspended and washed with chilled PBS twice, and stained with 5 µg/ml of CFSE dye on ice for 10 min. At the concentration of CFSE dye used, cytotoxic effects were not observed. The cell-permeant fluorescein-based dye attaches to cytoplasmic components of the cells, resulting in uniform brightness. On cell division, the dye is distributed equally between daughter cells, allowing the resolution of up to eight cycles of cell divisions by flow cytometry (10, 15). Cells were suspended at a final concentration of 5 x 107 cells/ml, washed with DMEM three times to remove nonspecific binding of the dye, and analyzed with a Beckman cell sorter. FITC-labeled beads were used to calibrate the input. Samples from the cells were collected on day 0 from albumin-free and albumin-supplemented cultures. The stained cells were activated by incubating in medium containing albumin and grown at 37°C in the dark. RLMVEC proliferation was checked in cells grown in the presence of the p38 MAPK inhibitor SB-203580 at concentrations of 10 and 20 µg/ml. In indicated experiments, cells were treated with 2 mM taxol or transfected with caveolin-1-specific siRNA or control siRNA (see Knockdown of caveolin-1 expression by siRNA) and starved for 24 h after 2 days of siRNA transfection. In one group of cells transfected with caveolin-1 siRNA albumin was supplemented in serum-free medium for 24 h, whereas the other group of cells were simply grown in serum-free medium. After 24 h, the CFSE fluorescence was measured and analyzed with a Beckman Coulter counter (Chaska, MN).

Coimmunoprecipitation of caveolin-1 and p38 MAPK. Immunoprecipitation and Western blotting were used to determine the molecular association between p38 MAPK and caveolin-1. Cell lysate preparation from RLMVEC, immunoprecipitation, Western blotting, and signal detection were carried out as described previously (24). About 250 µl of the total cell lysate containing an equal amount of total protein was incubated with 4 µg of rabbit polyclonal anti-p38 MAPK antibody. The immunoprecipitated proteins were separated by SDS-PAGE and Western blotted with anti-caveolin-1 antibody. In the first set of experiments, rabbit polyclonal affinity-purified anti-caveolin-1 antibody (sc-894, Santa Cruz Biotechnology) was used. Control rabbit IgG resulted in negative staining, whereas the anti-p38 MAPK antibody (sc-535) stained a band of 38 kDa. In controls, control IgG rabbit or primary antibody preadsorbed with the antigenic peptide did not stain the protein band corresponding to p38 MAPK. Experiments were also performed in reverse in which anti-p38 MAPK (sc-535) antibody was used for immunoprecipitation and anti-caveolin-1 antibody was used for Western blotting. When specific peptides were used to block the primary anti-caveolin-1 antibody, no staining was observed by immunoblot, indicating the specificity of the affinity-purified primary antibodies. The experiments were repeated three times and gave similar results.

Knockdown of caveolin-1 expression by siRNA. RLMVEC were grown to confluence on gelatin-coated cover glass and placed in six-well culture plates in 10% FBS-supplemented DMEM. The target sequences for caveolin-1 (GenBank accession no. BC009685) double-stranded (ds)RNA correspond to the 21 nucleotides 403–423 (AAGAGCTTCCTGATTGAGATT) of the coding sequence of human caveolin-1 (2). We determined by a BLAST search that this 21-nucleotide sequence is completely conserved in the human, mouse, and rat caveolin-1 genes. Cells were treated with either siRNA specific for caveolin-1 or sham siRNA with scrambled sequence that was checked with the NCBI Blast program. dsRNA corresponding to the caveolin-1 and sham dsRNA were purchased from Dharmacon (Lafayette, CO) and used according to the manufacturer's instructions. RLMVEC were seeded at a density of 5 x 104 cells on gelatin-coated glass coverslips 24 h before siRNA transfection. For each well, 200 µl of serum-free DMEM was mixed with 5 µl of Neophectin (Deerfield, IL) liposome-based transfection reagent and incubated at room temperature (RT) for 10 min. To this mixture, caveolin-1-specific or sham dsRNA was added and incubated for 10 min at RT. Cells were washed with 1 ml of serum-free medium and incubated with 30 ng of dsRNA or only the Neophectin-containing medium. Complete serum-containing medium (800 µl) was added to each well, and cells were incubated at 37°C in a humidified 5% CO2 chamber for 24 or 48 h. Downregulation of caveolin-1 expression was ascertained by both Western blotting and immunostaining using caveolin-1-specific antibody. The experiments were repeated three times and gave reproducible results.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Activation of endocytosis prevents loss of endothelial monolayer integrity. Figure 1Aa shows that RLMVEC grown in minimal medium (DMEM) in the absence of serum and other growth factors for 24 h lose their integrity as a monolayer, begin to detach from the surface, and show signs of cell degeneration. Cells also assumed a rounded phenotype (see arrow pointing to a cell beginning to detach, Fig. 1Aa). In contrast, cells grown in DMEM in the presence of 10% normal serum grew in a monolayer of typical cobblestone pattern that did not show gaps, cell rounding, or detachment (Fig. 1Ab). When serum-deprived cells were supplemented with physiological concentrations of albumin (BSA), the monolayer showed the same phenotype as cells grown in the presence of serum (Fig. 1Ad). Denatured albumin (treated with 50 mM reducing agent DTT) for 1 h and made free of DTT by dialysis of denatured DTT-albumin with three changes of 1 liter of PBS, failed to preserve RLMVEC monolayer integrity (Fig. 1Ac). We further tested the effects of denaturation of albumin by boiling albumin solution for 10 min, which also failed to preserve monolayer integrity of RLMVEC in serum-free medium (data not shown). There was no significant difference in the ability of recombinant human albumin, human serum albumin, or rat serum albumin (data not shown) to preserve monolayer integrity. We found that, in contrast, bovine immunoglobulin (10–200 µg/ml) or ovalbumin (100 µg/ml) could not be substituted for albumin (data not shown).


Figure 1
View larger version (57K):
[in this window]
[in a new window]

 
Fig. 1. A: albumin supplementation of serum-deprived endothelial cells promotes monolayer integrity. a: Rat lung microvessel endothelial cells (RLMVEC) grown in serum-deprived conditions (DMEM alone) for 24 h were rounded and showed loss of monolayer integrity. Arrow points to cell rounding before its detachment from the adherent surface. b: Cells grown in the presence of serum were adherent and formed a confluent, cobblestone monolayer. c: Addition of denatured albumin, treated with dithiothreitol bovine serum albumin (DTT BSA), failed to prevent loss of monolayer integrity induced by serum deprivation and rounding of cells (shown by arrows). d: Incubation of RLMVEC with albumin (BSA) induced cell confluence and enhanced monolayer integrity. Scale bar = 2 µm. Experiments were repeated 3 times, and results of typical experiments are represented. B: terminal deoxynucleotidyltransferase nick end labeling (TUNEL) staining of endothelial cells. a: RLMVEC grown in the presence of 4% albumin showed reduced or no TUNEL staining. b: Cells grown in serum-free medium without albumin supplementation showed apoptosis as seen by fragmented nuclei (marked with arrowheads). Since apoptotic cells detached from the monolayer, some nuclei appeared out of the focal plane. c: Cells grown in the presence of 4% albumin showing normal nuclear staining with 4',6'-diamidino-2-phenylindole (DAPI) nuclear dye. d: Appearance of fragmented nuclei (arrows) in cells grown in the serum-free medium without albumin, indicating apoptosis. e: In serum-starved cells there is 28% apoptosis without albumin supplementation. At 4% (wt/vol) albumin concentration, the apoptotic index is decreased to 8%. Results are means of n = 3, and bars indicate SD. *Significant reduction in apoptosis in the presence of 4% albumin supplementation.

 
We used TUNEL staining (Fig. 1B, a and b) and DAPI staining (Fig. 1B, c and d) to determine the number of cells undergoing apoptosis in RLMVEC monolayers grown in serum-free medium. We observed that supplementing serum-free medium with albumin reduced endothelial apoptosis (Fig. 1B). The percentage of cells undergoing apoptosis decreased from 22 ± 6% in the absence of albumin to 8 ± 4% in the presence of 4% (wt/vol) albumin, which is the physiological level (Fig. 1Be). There was no significant difference when BSA or rat serum albumin was substituted in these experiments (data not shown). These results were further confirmed by using FACS and TUNEL staining analyses to determine apoptosis. Results showed that albumin supplementation of serum-free medium reduced apoptosis and increased cell survival (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1. RLMVEC survival index

 
Addition of albumin to serum-deprived endothelial cells promotes cell proliferation in a p38 MAPK-dependent manner. To quantify the ability of albumin to promote cell proliferation, we used the CFSE dye-based dilution assay. This nontoxic cell-permeant fluorescein dye attaches to cytoplasmic components of cells, resulting in uniform brightness. On cell division, the dye is distributed equally (and thus diluted) between daughter cells, allowing resolution of up to eight cell cycles of cell division (15). Figure 2A shows fluorescence micrographs of RLMVEC stained with CFSE at days 0, 1, and 2 in RLMVEC grown in DMEM alone (Fig. 2A, a–c), after supplementation with 0.01% (100 µg/ml) albumin (Fig. 2A, d–f), and after albumin supplementation of cells treated with the p38 MAPK inhibitor SB-203580 (Fig. 2A, g–i). In contrast to serum-deprived cells grown in absence of albumin, cells grown in albumin-supplemented medium showed marked dilution of the dye within 2 days (Fig. 2A, d–f) indicative of cell proliferation. Arrows in Fig. 2A, e and f, indicate dilution of CFSE dye from day 0 to day 2 and formation of a confluent monolayer (Fig. 2Af), i.e., dilution of CFSE dye in albumin-supplemented cells was greater than in cells grown in albumin-free medium (Fig. 2A, a–c). Asterisks in Fig. 2Ac mark intercellular gaps that formed in endothelial monolayers. CFSE dilution similar to that seen in the absence of albumin supplementation was observed when albumin-supplemented RLMVEC were incubated in the presence of the p38 MAPK inhibitor SB-203580 (3, 6, 12) (Fig. 2A, g–i); gaps formed in endothelial monolayers treated with SB-203580 even on day 0 after 2 h of treatment (Fig. 2Ag) and were also evident on days 1 and 2 (asterisks, Fig. 2A, h and i). To address the possibility that CFSE dye could leak out of cells if cell proliferation is blocked, we used the microtubule-binding antiproliferative agent taxol (50 µM). In the taxol-treated cells, CFSE dye did not dilute (data not shown), suggesting that inhibition of proliferation resulted in an absence of dye dilution.


Figure 2
View larger version (45K):
[in this window]
[in a new window]

 
Fig. 2. A: carboxyfluorescein diacetate succinimidyl ester (CFSE) dye dilution assay. Fluorescence images of CFSE dye at days 0, 1, and 2 in cells in absence (a–c) or presence (d–f) of albumin supplementation or in presence of p38 mitogen-activated protein kinase (MAPK) inhibitor SB-203580 (g–i) are shown. The dye is diluted in the presence of albumin, as seen in f, but is not significantly reduced in c and i. Arrows show cells with CFSE dye in dilution from day 0 to days 1 and 2 (d–f), and asterisks show interjunctional gaps. SB-203580 inhibited CFSE dye dilution indicative of reduction of cell proliferation (g–i). Inhibition of p38 MAPK induced gap formation is marked by asterisk. Note the rounding of cells in day 2 shown in i following the treatment of cells with SB-203580. Experiments were repeated 3 times, and results of typical experiments are represented. B: fluorescence-activated cell sorting (FACS) analysis of endothelial cell proliferation. Proliferation of cells grown in albumin-free and albumin-containing media (see METHODS) was monitored by the CFSE dye dilution method using FACS. CFSE dye fluorescence is plotted on x-axis, and numbers of cells are plotted on y-axis. Solid thin line depicts cells grown in DMEM alone at day 0, and solid thick line depicts cells supplemented with BSA on day 0. The dashed thin line depicts cells grown in DMEM on day 1, and dashed thick line shows cells grown in medium supplemented with BSA on day 1. Shift was observed in cells in the presence of BSA, indicative of reduced CFSE dye fluorescence compared with cells in DMEM medium alone. Experiments were repeated 3 times, and typical examples of stained cells are shown.

 
We further used flow cytometry to measure cell proliferation in the presence and absence of albumin. Confluent cell monolayers were exposed to serum-free medium for 24 h. In one group 100 µg/ml albumin was supplemented, whereas in the other group RLMVEC were grown in albumin-free medium. Cells were detached with trypsin, suspended and washed twice with chilled PBS, and stained with 5 µg/ml of CFSE dye. Figure 2B shows the FACS profile of RLMVEC grown in the presence and absence of 0.01% albumin. The x-axis shows the fluorescence intensity in log units, and the y-axis shows the number of cells. The continuous thin line shows CFSE dye fluorescence at day 0 in cells grown in DMEM, and the thick line shows the cells supplemented with albumin at day 0. The thin dotted line shows CFSE dye distribution at day 1 in cells grown in DMEM, and the thick dotted line shows CFSE dye in cells supplemented with albumin on day 1. There was a greater shift (indicative of dye dilution) toward lower fluorescence intensity in cells grown in the presence of albumin compared with cells grown in DMEM alone. We examined the effects of taxol on RLMVEC survival and apoptosis with FACS analysis in serum-deprived conditions and when cells were supplemented with albumin. Taxol (2 mM) showed an increase in apoptosis in serum-deprived cells, whereas cells supplemented with albumin showed reduced apoptosis (Table 1). No significant increase in apoptosis in RLMVEC was observed when taxol was included in the medium at lower concentrations (100 µM to 1 mM) compared with cells grown in serum-free medium for 24 h (Table 1).

p38 MAPK inhibitor induces endothelial cell survival. To determine the role of p38 MAPK in RLMVEC survival and induction of apoptosis, we preincubated RLMVEC in serum-free medium or medium supplemented with 4% albumin with the p38 MAPK inhibitor SB-203580. Cells were analyzed with FACS and TUNEL staining as described above. Serum-free conditions reduced cell survival and promoted apoptosis, whereas addition of albumin improved cell survival (Table 1). SB-203580 slightly reduced the effects of serum deprivation on cell death. However, SB-203580 did not significantly alter the effect of albumin in promoting cell survival and reducing apoptosis in serum-deprived cells (Table 1).

TGF-beta and albumin supplementation induce p38 MAPK phosphorylation. We previously demonstrated (24) that engagement of endocytic machinery results in TbetaRII-activated signaling. Therefore, we investigated whether the TbetaRII ligand TGF-beta induces the phosphorylation of p38 MAPK in RLMVEC. Figure 3, A and B, immunoprecipitation of caveolin-1 using polyclonal anti-caveolin-1 antibody and Western blotting with anti-p38 MAPK antibody reveal that the two proteins are associated. In a reciprocal experiment in which cell lysates were immunoprecipitated with anti-p38 MAPK antibody, we detected caveolin-1 by Western blotting (Fig. 4). As a control, there was absence of caveolin-1 coimmunoprecipitation when normal rabbit IgG was used as the precipitating antibody.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 3. A: Transforming growth factor (TGF)-beta induces p38 MAPK phosphorylation. Time course of p38 MAPK phosphorylation induced with 2 ng/ml TGF-beta in RLMVEC grown in albumin-free medium as described in METHODS is shown. Cell lysates were prepared from each group of cells, and 60 µg protein was subjected to SDS-PAGE, Western blotted, and probed with rabbit polyclonal antibody raised against phosphorylated form of p38 MAPK (p38-P). p38-P-specific band was detected with secondary antibodies [goat anti-rabbit IgG conjugated with horseradish peroxidase (HRP)]. To correct for protein loading, blots were stripped and reprobed with polyclonal rabbit anti-p38 antibody. Experiments were repeated 3 times, and results of typical experiments are represented. B: densitometry plot depicting p38 MAPK phosphorylation. Amount of p38-P increased within 15 min of TGF-beta incubation and returned to basal level within 2 h. The experiment was repeated 3 times. Bars indicate SD. C: albumin supplementation induces p38 MAPK phosphorylation. RLMVEC were grown in albumin-free or albumin-supplemented medium as described in METHODS. Cell lysates were prepared from each group of cells, and 50 µg protein was subjected to SDS-PAGE, Western blotted, and probed with rabbit polyclonal antibody raised against p38-P. p38-P-specific band was detected with secondary antibodies (goat anti-rabbit IgG conjugated with HRP). For the protein amount control, the Western blot was stripped and reprobed with anti-p38 antibody (bottom). Experiments were repeated 3 times, and results of typical experiments are represented. D: densitometry of p38 MAPK phosphorylation. Amount of p38-P increased within 15 min of albumin addition and returned to basal level within 2 h. The experiment was repeated 3 times. Bars indicate SD. E: p38 MAPK activity. RLMVEC monolayers were grown and divided into 4 groups. In the 1st group, cells were grown in DMEM supplemented with 10% FBS. In the 2nd group, cells were grown in serum-free medium for 24 h. In the 3rd group, cells were grown in serum-free medium for 24 h and then supplemented with 100 µg/ml albumin for 1 h. In the 4th group, cells were grown in serum-free medium for 24 h and supplemented with 0.5 M NaCl for 30 min. Cells without albumin supplementation had low level of p38 kinase activity. Albumin (BSA) or FBS induced p38 MAPK activation. NaCl (0.5 M) was used as a positive control to induce p38 MAPK activation. These experiments were repeated 3 times. ATF-2-P, phospho-activating transcription factor-2.

 

Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 4. Coimmunoprecipitation (IP) of caveolin-1 (Cav-1) and p38-MAPK. A: cell lysates were prepared from RLMVEC as described in METHODS, and 250 µl of the total cell lysate was incubated with 4 µg of rabbit polyclonal anti-Cav-1 antibody. The precipitated proteins were run on 10% SDS-PAGE gels and immunoblotted (IB) with rabbit polyclonal anti-p38 MAPK antibody. Goat-anti-rabbit IgG antibody conjugated with HRP (diluted 1:2,000 in PBS) was used to detect the primary antibodies. In control experiments, precipitation was carried out with protein G-Sepharose beads alone or with a rabbit preimmune serum in place of the anti-Cav-1 antibody. B: in a reciprocal experiment, 300 µl of total cell lysate was incubated with 5 µg of rabbit polyclonal anti-p38 MAPK antibody. The immunoprecipitated proteins were run on a SDS-PAGE and immunoblotted as described in A, except that in the primary antibody incubation blots were incubated with rabbit polyclonal anti-Cav-1 antibody. Goat-anti-rabbit IgG antibody conjugated with HRP (diluted 1:2,000 in PBS) was used to detect the primary antibody. In control experiments, precipitation was done with protein G-Sepharose beads alone or with a rabbit preimmune serum in place of anti-p38 MAPK antibody. These experiments were repeated 3 times.

 
Albumin supplementation induces translocation of p38 MAPK. To determine the distribution of p38 MAPK and caveolin-1 in the serum-deprived condition and in the presence of albumin, we double-stained RLMVEC with a monoclonal antibody specific for caveolin-1 and a rabbit polyclonal antibody against the phosphorylated form of p38 MAPK (p38-P MAPK). Figure 5A Expression of p38 MAPK in caveolin-1 siRNA-treated cell lysate was not significantly altered (GoFig. 7B). We found reduction in the basal p38-P MAPK level in the caveolin-1 depleted cell lysate (Fig. 7A). The requirement of caveolin-1 expression in the induction of p38-P MAPK by albumin endocytosis was further examined by immunostaining. RLMVEC with normal caveolin-1 expression and cells in which caveolin-1 expression was reduced by siRNA were stained after albumin endocytosis (Fig. 7, C and D). Knockdown of caveolin-1 expression resulted in reduced basal expression of p38-P MAPK and inhibition of p38 phosphorylation on albumin supplementation compared with the RLMVEC with normal caveolin-1 expression (Fig. 7C).


Figure 5
View larger version (59K):
[in this window]
[in a new window]

 
Fig. 5. A: immunocytochemical staining of Cav-1 and p38 MAPK in serum-deprived endothelial cells. a: RLMVEC grown in serum-free medium for 24 h showing Cav-1 expression seen as green (Alexa 488) fluorescence in perinuclear regions and cytosol. b: p38-P MAPK expression shown as red (Alexa 594) fluorescence in nuclear and perinuclear regions and reduced staining in cytosol. Some nuclei are marked with an asterisk. c and d: Nuclear staining with DAPI alone (c) and merged with Cav-1 and p38-P staining (d). These experiments were repeated 3 times. B: albumin supplementation induces p38-P MAPK colocalization with Cav-1. a: Expression of Cav-1 in RLMVEC following albumin endocytosis shown by indirect immunofluorescence in green (Alexa 488). b: Expression of phosphorylated p38 MAPK in RLMVEC shown by red (Alexa 594) indirect immunofluorescence of p38-P staining. c: DAPI staining of cell nuclei shown in a and b. d: Merged view. Images show increased expression of p38 MAPK with Cav-1 in the cytosol following albumin supplementation. These experiments were repeated 3 times.

 

Figure 6
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 6. A: knockdown of caveolin-1 expression with small interfering RNA (siRNA). a–c: Immunostaining of Cav-1 expression by specific siRNA (c). In control cells in which only transfection reagent was used (a) or where sham siRNA was used (b), there is normal staining of Cav-1 by anti-Cav-1 antibody. d: Western blot shows Cav-1 expression in cells treated with transfection agent alone (lane 1), sham siRNA (lane 2), or Cav-1 siRNA (lane 3). A 22-kDa protein band is observed by immunoblot of lysate from RLMVEC treated with sham siRNA or with transfection reagent alone. This band is reduced by Cav-1 siRNA. Equal protein loading is shown in all 3 lanes by immunoblotting with anti-actin antibody. e: Ratio of Cav-1 to actin was calculated with densitometry and plotted (mean ± SD, n = 3). B: Cav siRNA-induced reduction of albumin endocytosis in endothelial cells. a: FITC-BSA endocytosis in RLMVEC monolayers treated with sham siRNA showing the highly punctate nature of albumin-containing vesicles. b: Reduction of FITC-BSA uptake in cells treated with Cav-1 siRNA for 48 h. a and b: Typical fluorescence patterns seen in 3 independent experiments. c: Time course of albumin endocytosis following Cav-1 knockdown: cells treated with Cav-1-specific siRNA. Black bars represent control (sham siRNA) showing normal endocytosis of FITC-albumin at 15-, 30-, and 60-min intervals. In contrast, RLMVEC treated with Cav-1 specific siRNA (light gray bars) for 48 h show 40% reduction in albumin endocytosis. Data are based on 3 independent experiments. *Significant reduction (P < 0.05) in endocytosis. C: effect of Cav-1 knockdown on endothelial monolayer integrity. a: Control RLMVEC treated with sham siRNA show normal confluent cobblestone pattern of monolayers. b: Cells grown in the presence of Cav-1 siRNA show a loss of integrity. Bar in a represents 5 µm. *Significant reduction in albumin uptake in the Cav-1 siRNA-treated RLMVEC.

 

Figure 7
View larger version (41K):
[in this window]
[in a new window]

 
Fig. 7. A: effect of siRNA-mediated Cav-1 knockdown on p38 MAPK phosphorylation. p38-P and Cav-1 Western blot from RLMVEC transfected with Cav-1 siRNA or control siRNA after induction of endocytosis with albumin is shown. As control, total p38 MAPK is shown at bottom. These experiments were repeated 3 times and gave similar results. B: densitometry of p38 MAPK phosphorylation. Induction of p38 MAPK phosphorylation by albumin supplementation in cells treated with control siRNA or with Cav-1 specific siRNA is shown. Inhibition of Cav-1 expression reduced p38 MAPK phosphorylation induced by albumin endocytosis. *Significant inhibition of p38 phosphorylation in RLMVEC treated with Cav-1 siRNA. C: immunostaining of Cav-1 and phospho p38-MAPK in control siRNA-treated RLMVEC induced by albumin endocytosis. Cells were starved in serum-free medium for 24 h (a and b) and treated with 4% albumin for 30 min at 37°C to induce endocytosis (c and d). Treated cells were fixed in formaldehyde, permeabilized with 0.1% Triton, and stained with mouse monoclonal anti-caveolin-1 monoclonal antibody (a) or rabbit anti-phospho-p38 MAPK polyclonal antibody (b) and examined using confocal microscopy. c: nuclear staining with DAPI. d: merged image. Scale bar = 20 µm. D: immunostaining of Cav-1 and phospho p38-MAPK in Cav-1 siRNA-treated RLMVEC induced by albumin endocytosis. RLMVEC were treated with Cav-1 siRNA for 48 h on glass coverslips as described. Treated cells were starved in serum-free medium for 24 h and stained as described with mouse anti-caveolin-1 monoclonal antibody (a) or rabbit anti-phospho-p38 MAPK antibody (b). Cav-1 siRNA-treated RLMVEC grown in serum-free medium were induced with endocytosis by supplementing cells with 4% albumin. Cells were stained as described with mouse anti-caveolin-1 monoclonal antibody (c) or rabbit anti-phospho-p38 MAPK antibody (d). Scale bar = 20 µm.

 
Caveolin-1 knockdown reduces cell survival. We investigated whether caveolin-1 expression affects cell survival in serum-starved and albumin-supplemented RLMVEC. Inhibition of caveolin-1 expression by siRNA reduced apoptosis when RLMVEC were grown in serum-free conditions compared with the RLMVEC transfected with control siRNA (Table 2). There was a decrease in cell survival when caveolin-1 siRNA-treated cells were grown in serum-free medium or after addition of albumin to activate endocytosis (Table 2).


View this table:
[in this window]
[in a new window]

 
Table 2. RLMVEC survival index

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The endocytic machinery in endothelial cells has multiple functions. It is known that endocytosis enables cells to regulate the surface expression of receptors by targeting them for degradation (4, 5, 7). Data presented here show another important function of endocytosis as induced by albumin supplementation of endothelial cells grown in serum-free conditions. We showed that activation of endocytosis was essential in regulating the p38 MAPK activity in endothelial cells. We demonstrated an interaction of p38 MAPK with caveolin-1, the principal marker of caveolae (19). On the basis of these findings, we propose that this interaction is crucial in regulating endothelial cell proliferation and survival and thereby in helping to maintain the integrity of the endothelial monolayer barrier.

Our findings showed that activation of endocytosis by albumin in serum-deprived endothelial cells was involved in reducing apoptosis and promoting proliferation of endothelial cells. The CFSE dye dilution assay (10, 15) and FACS analysis were used to demonstrate that albumin supplementation of endothelial cells resulted in the activation of endocytosis and thereby signaled endothelial cell proliferation. The TUNEL assay showed that endocytosis also reduced endothelial apoptosis and thereby promoted cell survival. Cell proliferation and survival were impaired in the absence of endocytosis induced by albumin supplementation. Native albumin appeared to be essential for the endocytosis response since albumin denaturation rendered it ineffective in activation of normal levels of endocytosis and promoting cell growth and reducing apoptosis. Recombinant albumin also has the same effect as native albumin (data not shown), suggesting that serum-associated constituents of albumin were not responsible for the effect.

We examined the role of the microtubule-stabilizing drug taxol in the presence and absence of albumin supplementation in regulating the endocytosis-induced endothelial cell survival response. In this experiment, albumin addition to the medium increased the survival of taxol-treated endothelial cells. At lower concentrations of the drug between 100 µM and 1 mM, no significant apoptosis was observed, whereas taxol induced apoptosis at 2 mM. Importantly, apoptosis was reduced when albumin was supplemented in the taxol-treated cells. These results demonstrate that activation of endocytosis plays a key role in promoting cell survival.

We previously reported (24) that TbetaRII-mediated signaling can activate caveolae-mediated endocytosis in endothelial cells. As p38 MAPK activation is downstream of TbetaRII activation (9, 27), we examined the possibility that signaling via the TbetaRII-p38 MAPK pathway is a requirement for endocytosis and the consequent endothelial cell growth and survival responses. We found that TGF-beta induced p38 MAPK phosphorylation and that inhibition of p38 MAPK by SB-203580 blocked endocytosis and interfered with endothelial proliferation and survival. These observations suggest an important role of endocytosis induced by the TbetaRII-p38 MAPK signaling pathway in activating endothelial proliferation and reducing endothelial apoptosis. Our results are in agreement with studies showing that p38 MAPK activation is a crucial determinant of cell proliferation (6, 13).

The mechanism responsible for activation of p38 MAPK following endocytosis is unclear (29, 30). The knockdown of caveolin-1 expression with siRNA resulted in a reduction in p38 MAPK phosphorylation. This finding suggests that caveolin-1-mediated signaling (22, 25) is involved in regulating p38 MAPK activation. Using high-throughput RNA interference and automated image analysis Pelkmans et al. (18) showed that Src and MAP kinases regulate caveolae-mediated endocytosis. The findings of Pelkmans et al. support our observation that activation of endocytosis regulates p38 MAPK activation and thus may control proliferation and survival of endothelial cells and the integrity of the endothelial monolayer. We observed that p38 MAPK phosphorylation did not last beyond 2 h, suggesting a negative-feedback downregulation of p38 MAPK activity. Other studies have demonstrated that MAPK activation via phosphorylation is also short-lived despite the near constant level of MAPK protein during the course of stimulation (28).

Our data show an association of p38 MAPK with caveolin-1 in endothelial cells following albumin supplementation of serum-deprived cells, a condition that activates caveolae-mediated endocytosis (11, 17). This finding raises the possibility that caveolin-1 is involved in p38 MAPK activation during endocytosis. We observed that siRNA-induced knockdown of caveolin-1 reduced endocytosis as well as cell survival. Caveolin-1 association with p38 MAPK secondary to caveolae-mediated endocytosis may be involved in p38 MAPK activation and thereby the engagement of endothelial cell proliferation signaling complex. However, the mechanisms responsible for the association of caveolin-1 and p38 MAPK and regulation of p38 MAPK activity remain unclear. As several kinases are inextricably linked to the endocytic machinery (18), the interaction of caveolin-1 and p38 MAPK may be important in bringing together components of the endocytic machinery and the signaling modules regulating endothelial cell proliferation and apoptosis.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Heart, Lung, and Blood Institute Grants P01-HL-60678 and R01-HL-71626.


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. S. Siddiqui, Dept. of Pharmacology, Univ. of Illinois College of Medicine, 835 South Wolcott Ave (M/C 868), Chicago, IL 60612 (e-mail: ssiddiqu{at}uic.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Alsayed Y, Uddin S, Mahmud N, Lekmine F, Kalvakolanu DV, Minucci S, Bokoch G, Platanias LC. Activation of Rac1 and the p38 mitogen-activated protein kinase pathway in response to all-trans-retinoic acid. J Biol Chem 276: 4012–4019, 2001.[Abstract/Free Full Text]
  2. Beardsley A, Fang K, Mertz H, Castranova V, Friend S, Liu J. Loss of caveolin-1 polarity impedes endothelial cell polarization and directional movement. J Biol Chem 280: 3541–3547, 2005.[Abstract/Free Full Text]
  3. Cuenda A, Alessi DR. Use of kinase inhibitors to dissect signaling pathways. Methods Mol Biol 99: 161–175, 2000.[Medline]
  4. Cavalli V, Vilbois F, Corti M, Marcote MJ, Tamura K, Karin M, Arkinstall S, Gruenberg J. The stress-induced MAP kinase p38 regulates endocytic trafficking via the GDI:Rab5 complex. Mol Cell 2: 421–432, 2001.
  5. Di Guglielmo GM, Le Roy C, Goodfellow AF, Wrana JL. Distinct endocytic pathways regulate TGF-beta receptor signalling and turnover. Nat Cell Biol 5: 410–421, 2003.[CrossRef][Web of Science][Medline]
  6. Engelman JA, Lisanti MP, Scherer PE. Specific inhibitors of p38 mitogen-activated protein kinase block 3T3-L1 adipogenesis. J Biol Chem 273: 32111–32120, 1998.[Abstract/Free Full Text]
  7. Ferguson SS. Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization, and signaling. Pharmacol Rev 53: 1–24, 2001.[Abstract/Free Full Text]
  8. Franzen P, ten Dijke P, Ichijo H, Yamashita H, Schulz P, Heldin CH, Miyazono K. Cloning of a TGF beta type I receptor that forms a heteromeric complex with the TGF beta type II receptor. Cell 75: 681–692, 1993.[CrossRef][Web of Science][Medline]
  9. Hanafusa H, Ninomiya-Tsuji J, Masuyama N, Nishiya M, Fujisawa J, Shibuya H, Matsumoto K, Nishida E. Involvement of the p38 mitogen-activated protein kinase pathway in transforming growth factor-beta-induced gene expression. J Biol Chem 274: 27161–27167, 1999.[Abstract/Free Full Text]
  10. Hodgkin PD, Lee JH, Lyons AB. B cell differentiation and isotype switching is related to division cycle number. J Exp Med 184: 277–281, 1996.[Abstract/Free Full Text]
  11. John TA, Vogel SM, Tiruppathi C, Malik AB, Minshall RD. Quantitative analysis of albumin uptake and transport in the rat microvessel endothelial monolayer. Am J Physiol Lung Cell Mol Physiol 284: L186–L197, 2003.
  12. Lee JC, Kassis S, Kumar S, Badger A, Adams JL. p38 mitogen-activated protein kinase inhibitors—mechanisms and therapeutic potentials. J Pharmacol Ther 82: 389–397, 1999.
  13. Li Y, Jiang B, Ensign WY, Vogt PK, Han J. Myogenic differentiation requires signalling through both phosphatidylinositol 3-kinase and p38 MAP kinase. Cell Signal 12: 751–757, 2000.[CrossRef][Web of Science][Medline]
  14. LoGrasso PV, Frantz B, Rolando AM, O'Keefe SJ, Hermes JD, O'Neill EA. Kinetic mechanism for p38 MAP kinase. Biochemistry 36: 10422–10427, 1997.[CrossRef][Medline]
  15. Lyons AB, Hasbold J, Hodgkin PD. Flow cytometric analysis of cell division history using dilution of carboxyfluorescein diacetate succinimidyl ester, a stably integrated fluorescent probe. Methods Cell Biol 63: 375–398, 2001.[Web of Science][Medline]
  16. Massague J. TGF-beta signal transduction. Annu Rev Biochem 67: 753–791, 1998.[CrossRef][Web of Science][Medline]
  17. Minshall RD, Sessa WC, Stan RV, Anderson RGW, Malik AB. Caveolin regulation of endothelial function. Am J Physiol Lung Cell Mol Physiol 285: L1179–L1183, 2003.[Abstract/Free Full Text]
  18. Pelkmans L, Fava E, Grabner H, Hannus M, Habermann B, Krausz E, Zerial M. Genome-wide analysis of human kinases in clathrin- and caveolae/raft-mediated endocytosis. Nature 436: 78–86, 2005.[CrossRef][Medline]
  19. Predescu S, Predescu D, Palade GE. Plasmalemmal vesicles function as transcytotic carriers for small proteins in the continuous endothelium. Am J Physiol Heart Circ Physiol 272: H937–H949, 1997.[Abstract/Free Full Text]
  20. Predescu D, Vogel SM, Malik AB. Functional and morphological studies of protein transcytosis in continuous endothelia. Am J Physiol Lung Cell Mol Physiol 287: L895–L901, 2004.[Abstract/Free Full Text]
  21. Razani B, Zhang XL, Bitzer M, von Gersdorff G, Bottinger EP, Lisanti MP. Caveolin-1 regulates transforming growth factor (TGF)-beta/SMAD signaling through an interaction with the TGF-beta type I receptor. J Biol Chem 276: 6727–6738,. 2001.
  22. Schubert W, Frank PG, Woodman SE, Hyogo H, Cohen DE, Chow CW, Lisanti MP. Microvascular hyperpermeability in caveolin-1(–/–) knockout mice. Treatment with a specific nitric-oxide synthase inhibitor, L-NAME, restores normal microvascular permeability in Cav-1 null mice. J Biol Chem 277: 40091–40098, 2002.[Abstract/Free Full Text]
  23. Shibuya H, Yamaguchi K, Shirakabe K, Tonegawa A, Gotoh Y, Ueno N, Irie K, Nishida E, Matsumoto K. TAB1: an activator of the TAK1 MAPKKK in TGF-beta signal transduction. Science 272: 1179–1182, 1996.[Abstract]
  24. Siddiqui SS, Siddiqui ZK, Malik AB. Albumin endocytosis in endothelial cells induces TGF-beta receptor II signaling. Am J Physiol Lung Cell Mol Physiol 286: L1016–L1026, 2004.[Abstract/Free Full Text]
  25. Williams TM, Lisanti MP. Caveolin-1 in oncogenic transformation, cancer, and metastasis. Am J Physiol Cell Physiol 288: C494–C506, 2005.[Abstract/Free Full Text]
  26. Wrana JL, Attisano L, Wieser T, Ventura F, Massague J. Mechanism of activation of the TGF-beta receptor. Nature 370: 341–347, 1994.[CrossRef][Medline]
  27. Yamaguchi K, Shirakabe K, Shibuya H, Irie K, Oishi I, Ueno N, Taniguchi T, Nishida E, Matsumoto K. Identification of a member of the MAPKKK family as a potential mediator of TGF-beta signal transduction. Science 27: 2008–2011, 1995.[CrossRef]
  28. Zarubin T, Han J. Activation and signaling of the p38 MAP kinase pathway. Cell Res 15: 11–18, 2005.[CrossRef][Web of Science][Medline]
  29. Zoellner H, Hofler M, Beckmann R, Hufnagl P, Vanyek E, Bielek E, Wojta J, Fabry A, Lockie S, Binder BR. Serum albumin is a specific inhibitor of apoptosis in human endothelial cells. J Cell Sci 109: 2571–2580, 1996.[Abstract]
  30. Zoellner H, Hou JY, Lovery M, Kingham J, Srivastava M, Bielek E, Vanyek E, Binder BR. Inhibition of microvascular endothelial apoptosis in tissue explants by serum albumin. Microvasc Res 57: 162–173, 1999.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
Cancer Prevention ResearchHome page
S. Paul, A. M. Rimando, H. J. Lee, Y. Ji, B. S. Reddy, and N. Suh
Anti-inflammatory Action of Pterostilbene Is Mediated through the p38 Mitogen-Activated Protein Kinase Pathway in Colon Cancer Cells
Cancer Prevention Research, July 1, 2009; 2(7): 650 - 657.
[Abstract] [Full Text] [PDF]


This Article
Free upon publication Free Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/L114    most recent
00257.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Siddiqui, S. S.
Right arrow Articles by Malik, A. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Siddiqui, S. S.
Right arrow Articles by Malik, A. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.