AJP - Lung Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Lung Cell Mol Physiol 292: L33-L39, 2007. First published August 11, 2006; doi:10.1152/ajplung.00170.2006
1040-0605/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/L33    most recent
00170.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ritz, S. A.
Right arrow Articles by Diaz-Sanchez, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ritz, S. A.
Right arrow Articles by Diaz-Sanchez, D.

Sulforaphane-stimulated phase II enzyme induction inhibits cytokine production by airway epithelial cells stimulated with diesel extract

Stacey A. Ritz, Junxiang Wan, and David Diaz-Sanchez

Hart and Louise Lyon Laboratory, Division of Clinical Immunology and Allergy, Department of Medicine, UCLA David Geffen School of Medicine, University of California, Los Angeles, California

Submitted 5 May 2006 ; accepted in final form 4 August 2006


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Airborne particulate pollutants, such as diesel exhaust particles, are thought to exacerbate lung and cardiovascular diseases through induction of oxidative stress. Sulforaphane, derived from cruciferous vegetables, is the most potent known inducer of phase II enzymes involved in the detoxification of xenobiotics. We postulated that sulforaphane may be able to ameliorate the adverse effects of pollutants by upregulating expression of endogenous antioxidant enzymes. Stimulation of bronchial epithelial cells with the chemical constituents of diesel particles result in the production of proinflammatory cytokines. We first demonstrated a role for phase II enzymes in regulating diesel effects by transfecting the airway epithelial cell line (BEAS-2B) with the sentinel phase II enzyme NAD(P)H: quinine oxidoreductase 1 (NQO1). IL-8 production in response to diesel extract was significantly reduced in these compared with untransfected cells. We then examined whether sulforaphane would stimulate phase II induction and whether this would thereby ablate the effect of diesel extracts on cytokine production. We verified that sulforaphane significantly augmented expression of the phase II enzyme genes GSTM1 and NQO1 and confirmed that sulforaphane treatment increased glutathione S-transferase activity in epithelial cells without inducing cell death or apoptosis. Sulforaphane pretreatment inhibited IL-8 production by BEAS-2B cells upon stimulation with diesel extract. Similarly, whereas diesel extract stimulated production of IL-8, granulocyte-macrophage colony-stimulating factor, and IL-1beta from primary human bronchial epithelial cells, sulforaphane pretreatment inhibited diesel-induced production of all of these cytokines. Our studies show that sulforaphane can mitigate the effect of diesel in respiratory epithelial cells and demonstrate the chemopreventative potential of phase II enzyme enhancement.

reduced nicotinamide adenine dinucleotide phosphate: quinine oxidoreductase 1; glutathione S-transferase; interleukin-8; air pollution; inflammation

AIRWAY INFLAMMATION IS BOTH a cause and feature of numerous pathogenic states. In respiratory diseases like asthma and chronic obstructive pulmonary disease (COPD), for example, inflammation causes acute and chronic changes in lung function and structure. Inflammation in the respiratory tract can also have extrapulmonary effects, since cytokines produced during local responses can have systemic consequences (45), such as the stimulation of the acute phase response and enhanced blood coagulability (24, 30, 32). Given that superfluous responses can hinder gas exchange and have adverse systemic effects, it is important to limit pulmonary inflammatory responses to those cases where it is necessary for host defense.

Air pollution induces local inflammation in the respiratory tract (28, 37) and has been associated with a variety of adverse health effects. Epidemiological studies have shown a consistent association between exposure to high levels of ambient particulate matter and an increased incidence of morbidity and mortality due to respiratory conditions and cardiovascular events (7, 15, 18, 31–33, 38, 39). The ability of oxidant pollutants, such as diesel exhaust particles (DEPs) and ozone, to enhance inflammation has also been confirmed in both human and animal in vivo models (5, 6). This ability is thought to be due to the generation of reactive oxygen species, which can activate redox-sensitive transcription factors, thereby regulating expression of many proinflammatory cytokines, including TNF-{alpha}, IL-6, and IL-8 (14, 23, 27, 34). Indeed, stimulation with chemical extracts of DEPs causes release of these cytokines from epithelial and monocytic cells.

The consequences of oxidative stress can be deleterious to the body; consequently, vertebrates have evolved protective defense mechanisms, including the phase II enzymes (which enzymatically modify toxic chemicals, lipid peroxides, and other by-products of inflammation) as one arm of the endogenous antioxidant defenses. Sulforaphane, an isothiocyanate compound derived from cruciferous vegetables, potently upregulates the expression of these enzymes (3, 9).

In this initial study, we test the concept that induction of phase II enzymes is a potential therapeutic strategy to block the adverse effects of oxidant pollutants. We show that sulforaphane treatment induces expression of phase II enzyme in bronchial epithelial cells (BECs) and inhibits the diesel extract (DX)-induced production of proinflammatory cytokine. These data indicate that sulforaphane may be effective in preventing the proinflammatory effects of DEPs and of oxidant pollutants more generally.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Sulforaphane and DEP extract. D,L-sulforaphane [1-isothiocyanato-(4R)-methylsulfinyl-butane; CH3S(CH2)4NCS] was obtained from LKT Laboratories (St. Paul, MN), stored at –20°C, and diluted in PBS for addition to epithelial cultures.

Extract of DEPs (DX) was prepared as previously described (21). Briefly, 100 mg of DEPs [generated from a light-duty four-cylinder diesel engine (4JB1 type, Isuzu Automobile) using standard fuel and provided by Dr. M. Sagai] were suspended in 25 ml of methanol and sonicated for 2 min, followed by centrifugation at 2,000 rpm for 10 min at 4°C. The supernatant was transferred to a polypropylene tube and dried under nitrogen gas, dissolved in DMSO at a concentration of 100 µg/µl, and stored in the dark at –80°C. For a detailed comparison of the chemical and physical characteristics of these DEPs, and their comparative pulmonary toxicology to the NIST standard DEPs, see Singh et al. (41).

BEC cultures. The transformed human BEC line BEAS-2B was obtained from the American Type Culture Collection (ATCC no. CRL-9609; Manassas, VA) and cultured in serum-free LHC-8 medium supplemented with retinoic acid, epinephrine, and penicillin/streptomycin (all from Biosource, Camarillo, CA). Normal human BECs (NHBECs) were obtained from Cambrex (East Rutherford, NJ) and cultured in BEGM-Bulletkit bronchial epithelial medium (Cambrex).

Cells were plated into 6- or 24-well plates and grown to ~80% confluence; for BEAS-2B cells, plates were precoated with collagen (Vitrogen, Angiotech, Palo Alto, CA), fibronectin (Calbiochem), and bovine serum albumin (Biosource). Because epinephrine has been reported to suppress cytokine expression by BECs (36), cells were washed with HEPES-buffered saline (Biosource), and fresh epinephrine-free medium was added 24 h before stimulation.

BEAS-2B and NHBECs were stimulated with 5 µM sulforaphane, or media control for 24 h, harvested, and used to determine NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) M1 (GSTM1) gene expression. Stimulation with DX or vehicle (DMSO) was performed in the presence or absence of 24-h pretreatment with sulforaphane. After 24 h, supernatants were harvested for cytokine production; this time point was chosen after preliminary experimentation indicated that this was the most robust point for measurement (data not shown).

NQO1 plasmid construction, cell transfection, and Western blot. The NQO1 coding region was subcloned into pcDNA-3.1 vector. The fragment of 822 bp was amplified by the sense primer 5' GGCGAAGCTTATGGTCGGCAGAAGAGCACT 3' with Hind III site and antisense primer 5' CGGCCTCGAGTTTTCTAGCTTTGATCTG GT 3' with Xho I site. The PCR product and the pcDNA 3.1 vector were digested with restriction endonuclease enzymes Hind III and Xho I (New England Biolaboratories, Beverly, MA) at 37°C for 2 h. After the purification, the PCR product was cloned into Hind III and Xho I sites of pcDNA 3.1 vectors by using T4 DNA ligase at 16°C overnight. The positive plasmid was checked by DNA sequencing.

Human BEAS-2B cells were grown in 12-well plates in LHC-9 medium. The Lipofectamine 2000 transfection reagent kit (Invitrogen) was used to transfect the cells with pcDNA-NQO1 per manufacturer's protocol. Thirty-six hours later, the cells were collected for NQO1 protein assay by Western blot, performed as previously described. Briefly, cells were lysed, and 40 µg total protein were used for 10% SDS-PAGE and transferred to PVDF membrane, which was incubated with 1:2,000 goat anti-NQO1 antibody (Abcam, Cambridge, MA) for 1 h. After washing, the membrane was incubated with 1:5,000 horseradish peroxidase-labeled donkey anti-goat IgG (Abcam) for 1 h and detected by enhanced chemiluminescence (Amersham, Piscatway, NJ) Western blot kit. beta-Actin was used as an internal control. The membrane was then stripped and reblocked by 5% nonfat milk for 3 h and then incubated with 1:2,000 anti-beta-actin antibody for 1 h followed by washing and incubation with 1:2,500 secondary antibody.

Transfected and sham-transfected cells were stimulated with DX, 36 h after transfection, at various concentrations (0, 20, 50, 100 µg/ml). The medium was collected for IL-8 assay after 24-h treatment.

Real-time quantitative PCR analysis of phase II enzyme expression. RNA was isolated from cultured cells using TRIzol (Invitrogen), according to the manufacturer's instructions. Genomic DNA was removed using DNAse I (Gibco, Carlsbad, CA, catalog no. 18196–022), and cDNA was generated using Superscript II (Gibco, no. 18064–014) using random hexamers (Gibco). The FAM-labeled primer/probe set for NQO1 and VIC-labeled primer/probe set for beta-actin were obtained from Applied Biosystems (Foster City, CA). Primers for GSTM1 were obtained from Sigma-Genosys (The Woodlands, TX); the primer sequences are 5'-ATGATACTGGGGTACTGGGA for the forward primer and 5'-ATCAAGTAGGGCAGATTGGG for the reverse.

PCR was carried out in the ABI Prism 7700 Sequence Detection System under the control of Sequence Detector version 1.9 software (Applied Biosystems), using either TaqMan Universal PCR Master Mix (Applied Biosystems) or Platinum SYBRgreen qPCR SuperMix-UDG with ROX (Invitrogen). Gene expression was quantitated relative to the expression of the housekeeping gene by the {Delta}{Delta}Ct (threshold cycle) method, and expression was further normalized to background expression in untreated cells.

GST activity and cell viability. Total GST activity was measured following the use of 1-chloro-2,4-dinitrochlorobenzene (CDNB) agents using the technique of Habig et al. (13); briefly, cells were harvested and washed by PBS (pH 7.4) at 4°C. Cytosolic fractions were prepared by sonication and ultracentrifugation, as previously described (43). Activity was then followed by measuring the conjugation of 1 mM CDNB with 1 mM GSH at 37°C in 200 mM sodium phosphate buffer (pH 6.5), as measured at 340 nm using a spectrophotometer over time. Enzyme activity was expressed as millimoles of CDNB conjugated per minute per milligram of cytosolic protein. Cell viability was determined by staining with propidium iodide and apoptosis by Annexin V staining, as previously described (46).

Measurement of cytokines. Cytokines were measured in cell culture supernatants by sandwich ELISA using BD OptEIA antibody sets for human IL-8, granulocyte-macrophage colony-stimulating factor (GM-CSF), and IL-1beta (BD Biosciences, San Diego, CA), following the manufacturer's instructions. The limit of detection for these assays was 5 pg/ml.

Data analysis. Data are expressed as means ± SD, unless otherwise indicated. Statistical analysis was conducted using Systat 11. One-way ANOVA was applied to the data, and the Tukey post hoc test was used to determine statistically significant differences (P < 0.05) between groups.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Overexpression of the sentinel phase II enzyme NQO1 can inhibit DX-induced cytokine production. Our initial experiment established a role for phase II enzymes in regulating diesel effects. It has been well established that particulate pollution induces the expression of proinflammatory cytokines such as IL-8 from BECs. Figure 1 shows that IL-8 release by BEAS-2B cells upon stimulation with DX was reduced in cells transfected with the sentinel phase II enzyme NQO1 compared with sham-transfected controls. Increased NQO1 protein in transfected cells was confirmed by Western blot assay.


Figure 1
View larger version (33K):
[in this window]
[in a new window]

  		Fig. 1. NAD(P)H: quinine oxidoreductase 1 (NQO1) overexpression decreases IL-8 production in diesel extract (DX)-stimulated BEAS-2B cells. A: Western blot of NQO1 protein 36 h after transfection with pcDNA-NQO1. B: IL-8 production 24 h after stimulation with DX. {circ}, Control-transfected cells; bullet, pcDNA-NQO1-transfected cells. Data are shown as means ± SD (n = 4). *Statistically significant difference (P < 0.05) compared with control cells at same DX dose.

 
Induction of phase II enzyme expression by sulforaphane. Sulforaphane increased gene expression of phase II enzymes in a BEC line and in primary cultures of human airway epithelial cells (Fig. 2). Compared with baseline, sulforaphane treatment upregulated NQO1 expression in BEAS-2B cells ~15-fold. Treatment of NHBECs with sulforaphane also upregulated NQO1 expression, albeit to a lower extent; relative expression of NQO1 was threefold higher in treated NHBECs compared with untreated controls.


Figure 2
View larger version (7K):
[in this window]
[in a new window]

  		Fig. 2. Sulforaphane increases expression of phase II enzyme genes in bronchial epithelial cells (BECs). Gene expression of NQO1 and glutathione S-transferase M1 (GSTM1) in BEAS-2B (A) and normal human BECs (NHBECs; B) stimulated with sulforaphane for 24 h is shown. Open bars indicate gene expression in untreated control cells; solid bars show expression in cells treated with 5 µM sulforaphane. Data are shown as means ± SD (n = 3) of one representative experiment. *Significant increase in gene expression (P < 0.05) compared with control.

 
In contrast, BEAS-2B cells and NHBECs had different responses to sulforaphane with respect to GSTM1. Although sulforaphane treatment did not upregulate GSTM1 expression in BEAS-2B cells, NHBECs showed a significant approximately twofold induction of gene expression for GSTM1.

Sulforaphane also enhanced enzyme activity in both BEAS-2B cells and NHBECs (Table 1). GST activity in cells stimulated with sulforaphane increased in a dose-dependent fashion. No change in cell viability and no indication of apoptosis was observed at any concentration <10 µg/ml at 24 h (data not shown).


View this table:
[in this window]
[in a new window]

  		Table 1. GST activity in BEAS-2B epithelial cells stimulated with sulforaphane for 24 h

 
DX-induced proinflammatory cytokine production is suppressed by sulforaphane treatment in BEAS-2B cells. Pretreatment with sulforaphane inhibited the production of the proinflammatory cytokine IL-8 by BEAS-2B cells upon stimulation with DX (Fig. 3). DX at concentrations of 10 µg/ml or higher augmented IL-8 production in untreated cells. Sulforaphane treatment alone had no significant effect on basal IL-8 production at any dose. However, pretreatment with sulforaphane attenuated DX-induced production of IL-8. Statistically significant reduction of IL-8 production was seen beginning at a dose of 3.125 µM sulforaphane, and IL-8 production was reduced to background levels at a dose of 6.25 µM sulforaphane. Again, no toxicity was observed at these concentrations (data not shown). Neither GM-CSF nor IL-1beta was detectable in supernatants from BEAS-2B cells.


Figure 3
View larger version (17K):
[in this window]
[in a new window]

  		Fig. 3. Sulforaphane inhibits DX-induced IL-8 by BEAS-2B cells. IL-8 was measured in cells stimulated with DX or control after 24 h (A) and cells treated with sulforaphane for 24 h before 24-h stimulation with DX at 25 µg/ml ({triangleup}), 10 µg/ml ({blacksquare}), or vehicle only (0.25% DMSO) ({circ}) (B). Data are shown as means ± SD (n = 3) of one representative experiment. *Significant increase in IL-8 production (P < 0.05) from the vehicle control at same sulforaphane dose. {dagger}Significant reduction in IL-8 production (P < 0.05) compared with the 0 sulforaphane control at the same DX dose.

 
Cytokine production by primary human BECs is also suppressed by sulforaphane treatment. Sulforaphane was also effective in inhibiting DX-induced cytokine production in primary cultures of NHBECs. Increased production of IL-8 was observed when DX was present at 10 µg/ml or higher (Fig. 4A). Pretreatment of cultures with sulforaphane had a significant impact on IL-8 production (Fig. 5A), and this effect was observed at much lower concentrations in the NHBEC cultures than in the BEAS-2B cultures.


Figure 4
View larger version (13K):
[in this window]
[in a new window]

  		Fig. 4. DX increased cytokine expression by NHBECs. IL-8 (A), granulocyte-macrophage colony-stimulating factor (GM-CSF; B), and IL-1beta (C) production in untreated cells (no tx), or cells treated with vehicle (DMSO 0.25%) or DX for 24 h are shown. Data are shown as means ± SD (n = 3) of one representative experiment. *Significant increase in cytokine production (P < 0.05) from 0 µg/ml DX.

 

Figure 5
View larger version (16K):
[in this window]
[in a new window]

  		Fig. 5. Sulforaphane (SULF) inhibits DX-increased cytokine expression by NHBECs. IL-8 (A), GM-CSF (B), and IL-1beta (C) production is shown in untreated cells or cells treated with sulforaphane for 24 h. Cytokine levels were measured 24 h after stimulation with vehicle only (0.25% DMSO) (bullet) or DX at 10 ({square}) or 25 µg/ml ({blacktriangleup}). Data are shown as means ± SD (n = 3) of one representative experiment. *Significant increase in cytokine production (P < 0.05) from the 0 DX control at same sulforaphane dose. {dagger}Significant reduction in cytokine production (P < 0.05) compared with the no sulforaphane control at the same DX dose.

 
Unlike BEAS-2B cells, NHBECs also secreted detectable levels of GM-CSF and IL-1beta. Detectable levels of GM-CSF and IL-1beta were expressed under basal conditions (Fig. 4, B and C). Stimulation with 10 µg/ml DX marginally increased production of both GM-CSF and IL-1beta over baseline; production of these cytokines was substantially enhanced upon stimulation with 25 µg/ml DX. As with IL-8, pretreatment of NHBECs with sulforaphane inhibited the production of GM-CSF and IL-1beta upon stimulation with the higher dose of DX (Fig. 5, B and C).


   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
This study establishes the principle of enhancing natural cytoprotective responses as a potential therapeutic strategy against the proinflammatory effects of oxidant pollutants. In this study, we show that sulforaphane can both upregulate phase II enzyme expression and block DX-induced IL-8, GM-CSF, and IL-1beta production, providing support for the potential of using a chemopreventative strategy to counteract the prooxidant effects of air pollutants. Previously, sulforaphane has been studied most extensively for its potential as an anti-carcinogenic agent. This is the first study to examine the concept that induction of phase II enzymes through chemoprevention may moderate the proinflammatory impact of oxidant pollutants such as diesel exhaust.

Airborne particulates are known to exacerbate existing respiratory and cardiovascular conditions, and there is a strong epidemiological association between episodes of poor air quality and increased morbidity and mortality. Mounting evidence indicates that particulate matter can also contribute to the development of these disorders as well, for example, accelerating the progression of atherosclerosis (19, 42) and acting as an adjuvant for the development of allergic immune responses (5, 6). As has been highlighted by us and many others, air pollutants are toxic in part due to their ability to induce oxidative stress (22, 27, 47). The generation of reactive oxygen species upon exposure to airborne pollutants causes the activation of the NF-{kappa}B and MAP kinase pathways, which transcriptionally regulate the production of proinflammatory cytokines by the airway epithelium, which, in turn, initiates a cascade of effects that result in local inflammatory responses (14, 34, 36). In addition to the exacerbation of existing airway disease, these responses may also predispose to the development of acute cardiovascular events, through the systemic spillover of cytokines and induction of the acute phase response (18). Given the central role of oxidative stress in mediating these pathways, antioxidant strategies have been identified as being potentially beneficial in the treatment and prevention of pollution-induced exacerbations of cardiorespiratory disease. In addition, oxidative stress occurs, not only as a result of exposure to airborne oxidant pollutants, but also as an outcome of inflammatory processes themselves, such as those in asthma or COPD (2, 8, 35), and augmentation of antioxidant defenses in the respiratory tract may be beneficial in such diseases as well, independently of air pollution exposure.

Sulforaphane is an isothiocyanate derived from cruciferous vegetables and is the most potent known naturally occurring inducer of the phase II enzyme genes (9). Phase II enzymes, including the GSTs, NQO1, and others, detoxify electrophiles and reactive oxygen species by several mechanisms, including mediating their conjugation with endogenous ligands that promote their excretion. We used sulforaphane in these studies because of its potency in inducting phase II enzyme expression, as well as its demonstrated tolerability in human studies. Moreover, the top concentration used by us (6.25 µM) is well within the physiologically achievable range, as indicated in studies of oral dosing with sulforaphane in rats (16), or consumption of high-glucosinolate broccoli in humans (11).

Antioxidant strategies may be especially beneficial in individuals who have reduced or absent phase II enzyme activity, such as may occur with certain genetic polymorphisms. Such mutations are very common; for example, the null polymorphism in the GST µ (GSTM1) gene, present in up to 50% of some populations (4); similarly, a nonfunctional polymorphism in the gene for NQO1 (NQO1*2) is present in ~20% of Caucasians and can approach ~50% in other ethnic groups (10). Although there are numerous phase II enzyme genes, and one might hypothesize that the absence of a single one of these would not have a major impact, in fact, people with GST polymorphisms have been shown to be more susceptible to the development of certain cancers (17, 25, 48) and also to be more sensitive to the adverse effect of air pollutants (12, 20). In this study, we demonstrated that sulforaphane upregulated the expression of GSTM1 and NQO1 in primary human airway epithelial cells. Although these genes were selected as markers of sulforaphane effects on phase II enzyme expression, there are doubtless many more genes involved that will likely play a role in detoxification and antioxidant defense and will likely be involved in imparting protection from oxidant pollutants. The data presented here suggest that this is indeed the case: despite the absence of a detectable change in GSTM1 gene expression in BEAS-2B cells in response to sulforaphane (Fig. 2), GST activity was clearly increased (Table 1). Moreover, although NHBECs had apparently lower induction of NQO1 gene expression compared with BEAS-2B cells (Fig. 2), sulforaphane was effective in eliciting GST activity (Table 1) and damping DX-induced cytokine expression at much lower doses in NHBECs than in BEAS-2Bs (Figs. 3 and 5). Since these genes have overlapping substrates, induction might compensate for the absence of individual gene function in individuals with null polymorphisms. Thus the potential benefits of treatments may be especially enhanced in these individuals.

However, it is important to note that, although the induction of phase II enzymes is usually considered to be beneficial, in some cases these enzymes can bioactivate several hazardous chemicals and possibly induce cell death via ROS generation (29, 40). Such an effect is not without precedent: the use of beta-carotene supplementation increased, rather than decreased, cancer risk in a population of smokers (1). Thus it will be important to carefully assess both the potential risks and benefits in the use of sulforaphane clinically.

We cannot categorically state that the upregulation of phase II enzymes is the sole mechanism by which sulforaphane protects from the proinflammatory effects of DX in these studies. Sulforaphane treatment can induce the expression of many different genes (44) and can have effects on cell cycle, apoptosis, the activity of histone deacetylase, and many other processes (26). However, our finding that transfection of epithelial cells with just one phase II enzyme can reduce the effects of diesel certainly suggests that phase II enzyme induction is a likely, if not unique, mechanism by which sulforaphane exerts its effects in our system.

In conclusion, we have shown that pretreatment with sulforaphane effectively limits the proinflammatory effects of DX on airway epithelial cells, concomitant with an upregulation of key phase II enzyme genes. While it still needs to be demonstrated that this will be similarly effective and safe in vivo, these results support the potential use of sulforaphane-based strategies to limit pollution-induced local inflammatory responses, which could prevent exacerbations of asthma or COPD, or the induction of cardiovascular events, particularly in susceptible individuals.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This study was supported by the US Environmental Protection Agency and the National Institute for Environmental Health Sciences.

Present address of S. A. Ritz: Northern Ontario School of Medicine, East Campus, Laurentian University, 935 Ramsey Lake Rd., Sudbury ON, P3E 2C6, Canada.


   ACKNOWLEDGMENTS
 
The authors thank Ling Zhang and Minna Jyrala for technical support of this project.


   FOOTNOTES
 

Address for reprint requests and other correspondence: S. A. Ritz, Medical Sciences Division, Northern Ontario School of Medicine, East Campus - Laurentian Univ., 935 Ramsey Lake Rd., Sudbury, ON P3E 2C6, Canada (e-mail: stacey.ritz{at}normed.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Blumberg J and Block G. The Alpha-Tocopherol, Beta-Carotene Cancer Prevention Study in Finland. Nutr Rev 52: 242–245, 1994.[Web of Science][Medline]
  2. Bowler RP and Crapo JD. Oxidative stress in allergic respiratory diseases. J Allergy Clin Immunol 110: 349–356, 2002.[CrossRef][Web of Science][Medline]
  3. Brooks JD, Paton VG, and Vidanes G. Potent induction of phase 2 enzymes in human prostate cells by sulforaphane. Cancer Epidemiol Biomarkers Prev 10: 949–954, 2001.[Abstract/Free Full Text]
  4. Chen CL, Liu Q, and Relling MV. Simultaneous characterization of glutathione S-transferase M1 and T1 polymorphisms by polymerase chain reaction in American whites and blacks. Pharmacogenetics 6: 187–191, 1996.[CrossRef][Web of Science][Medline]
  5. Diaz-Sanchez D, Garcia MP, Wang M, Jyrala M, and Saxon A. Nasal challenge with diesel exhaust particles can induce sensitization to a neoallergen in the human mucosa. J Allergy Clin Immunol 104: 1183–1188, 1999.[CrossRef][Web of Science][Medline]
  6. Diaz-Sanchez D, Tsien A, Casillas A, Dotson AR, and Saxon A. Enhanced nasal cytokine production in human beings after in vivo challenge with diesel exhaust particles. J Allergy Clin Immunol 98: 114–123, 1996.[CrossRef][Web of Science][Medline]
  7. Dockery DW, Pope CA, 3rd Xu X, Spengler JD, Ware JH, Fay ME, Ferris BG Jr, and Speizer FE. An association between air pollution and mortality in six U. S. cities. N Engl J Med 329: 1753–1759, 1993.[Abstract/Free Full Text]
  8. Drost EM, Skwarski KM, Sauleda J, Soler N, Roca J, Agusti A, and MacNee W. Oxidative stress and airway inflammation in severe exacerbations of COPD. Thorax 60: 293–300, 2005.[Abstract/Free Full Text]
  9. Fahey JW and Talalay P. Antioxidant functions of sulforaphane: a potent inducer of Phase II detoxication enzymes. Food Chem Toxicol 37: 973–979, 1999.[CrossRef][Web of Science][Medline]
  10. Gaedigk A, Tyndale RF, Jurima-Romet M, Sellers EM, Grant DM, and Leeder JS. NAD(P)H:quinone oxidoreductase: polymorphisms and allele frequencies in Caucasian, Chinese and Canadian Native Indian and Inuit populations. Pharmacogenetics 8: 305–313, 1998.[CrossRef][Web of Science][Medline]
  11. Gasper AV, Al-Janobi A, Smith JA, Bacon JR, Fortun P, Atherton C, Taylor MA, Hawkey CJ, Barrett DA, and Mithen RF. Glutathione-S-transferase M1 polymorphism and metabolism of sulforaphane from standard and high-glucosinolate broccoli. Am J Clin Nutr 82: 1283–1291, 2005.[Abstract/Free Full Text]
  12. Gilliland FD, Li YF, Saxon A, and Diaz-Sanchez D. Effect of glutathione-S-transferase M1 and P1 genotypes on xenobiotic enhancement of allergic responses: randomised, placebo-controlled crossover study. Lancet 363: 119–125, 2004.[CrossRef][Web of Science][Medline]
  13. Habig WH, Pabst MJ, and Jakoby WB. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J Biol Chem 249: 7130–7139, 1974.[Abstract/Free Full Text]
  14. Hashimoto S, Gon Y, Takeshita I, Matsumoto K, Jibiki I, Takizawa H, Kudoh S, and Horie T. Diesel exhaust particles activate p38 MAP kinase to produce interleukin 8 and RANTES by human bronchial epithelial cells and N-acetylcysteine attenuates p38 MAP kinase activation. Am J Respir Crit Care Med 161: 280–285, 2000.[Abstract/Free Full Text]
  15. Hoek G, Brunekreef B, Goldbohm S, Fischer P, and van den Brandt PA. Association between mortality and indicators of traffic-related air pollution in the Netherlands: a cohort study. Lancet 360: 1203–1209, 2002.[CrossRef][Web of Science][Medline]
  16. Hu R, Hebbar V, Kim BR, Chen C, Winnik B, Buckley B, Soteropoulos P, Tolias P, Hart RP, and Kong AN. In vivo pharmacokinetics and regulation of gene expression profiles by isothiocyanate sulforaphane in the rat. J Pharmacol Exp Ther 310: 263–271, 2004.[Abstract/Free Full Text]
  17. Kiyohara C. Genetic polymorphism of enzymes involved in xenobiotic metabolism and the risk of colorectal cancer. J Epidemiol 10: 349–360, 2000.[Medline]
  18. Krewski D, Burnett RT, Goldberg MS, Hoover K, Siemiatycki J, Abrahamowicz M, and White WH. Validation of the Harvard Six Cities Study of particulate air pollution and mortality. N Engl J Med 350: 198–199, 2004.[Free Full Text]
  19. Kunzli N, Jerrett M, Mack WJ, Beckerman B, LaBree L, Gilliland F, Thomas D, Peters J, and Hodis HN. Ambient air pollution and atherosclerosis in Los Angeles. Environ Health Perspect 113: 201–206, 2005.[Web of Science][Medline]
  20. Lee YL, Lin YC, Lee YC, Wang JY, Hsiue TR, and Guo YL. Glutathione S-transferase P1 gene polymorphism and air pollution as interactive risk factors for childhood asthma. Clin Exp Allergy 34: 1707–1713, 2004.[CrossRef][Web of Science][Medline]
  21. Li N, Alam J, Venkatesan MI, Eiguren-Fernandez A, Schmitz D, Di Stefano E, Slaughter N, Killeen E, Wang X, Huang A, Wang M, Miguel AH, Cho A, Sioutas C, and Nel AE. Nrf2 is a key transcription factor that regulates antioxidant defense in macrophages and epithelial cells: protecting against the proinflammatory and oxidizing effects of diesel exhaust chemicals. J Immunol 173: 3467–3481, 2004.[Abstract/Free Full Text]
  22. Li N, Hao M, Phalen RF, Hinds WC, and Nel AE. Particulate air pollutants and asthma. A paradigm for the role of oxidative stress in PM-induced adverse health effects. Clin Immunol 109: 250–265, 2003.[CrossRef][Web of Science][Medline]
  23. Li N, Venkatesan MI, Miguel A, Kaplan R, Gujuluva C, Alam J, and Nel A. Induction of heme oxygenase-1 expression in macrophages by diesel exhaust particle chemicals and quinones via the antioxidant-responsive element. J Immunol 165: 3393–3401, 2000.[Abstract/Free Full Text]
  24. Liao D, Heiss G, Chinchilli VM, Duan Y, Folsom AR, Lin HM, and Salomaa V. Association of criteria pollutants with plasma hemostatic/inflammatory markers: a population-based study. J Expo Anal Environ Epidemiol 15: 319–328, 2005.[CrossRef][Web of Science][Medline]
  25. Miller DP, De Vivo I, Neuberg D, Wain JC, Lynch TJ, Su L, and Christiani DC. Association between self-reported environmental tobacco smoke exposure and lung cancer: modification by GSTP1 polymorphism. Int J Cancer 104: 758–763, 2003.[CrossRef][Web of Science][Medline]
  26. Myzak MC, Hardin K, Wang R, Dashwood RH, and Ho E. Sulforaphane inhibits histone deacetylase activity in BPH-1, LnCaP and PC-3 prostate epithelial cells. Carcinogenesis 27: 811–819, 2006.[Abstract/Free Full Text]
  27. Nel AE, Diaz-Sanchez D, and Li N. The role of particulate pollutants in pulmonary inflammation and asthma: evidence for the involvement of organic chemicals and oxidative stress. Curr Opin Pulm Med 7: 20–26, 2001.[CrossRef][Medline]
  28. Nightingale JA, Maggs R, Cullinan P, Donnelly LE, Rogers DF, Kinnersley R, Chung KF, Barnes PJ, Ashmore M, and Newman-Taylor A. Airway inflammation after controlled exposure to diesel exhaust particulates. Am J Respir Crit Care Med 162: 161–166, 2000.[Abstract/Free Full Text]
  29. Paolini M, Perocco P, Canistro D, Valgimigli L, Pedulli GF, Iori R, Croce CD, Cantelli-Forti G, Legator MS, and Abdel-Rahman SZ. Induction of cytochrome P450, generation of oxidative stress and in vitro cell-transforming and DNA-damaging activities by glucoraphanin, the bioprecursor of the chemopreventive agent sulforaphane found in broccoli. Carcinogenesis 25: 61–67, 2004.[Abstract/Free Full Text]
  30. Peters A, Frohlich M, Doring A, Immervoll T, Wichmann HE, Hutchinson WL, Pepys MB, and Koenig W. Particulate air pollution is associated with an acute phase response in men; results from the MONICA-Augsburg Study. Eur Heart J 22: 1198–1204, 2001.[Abstract/Free Full Text]
  31. Peters A and Pope CA 3rd. Cardiopulmonary mortality and air pollution. Lancet 360: 1184–1185, 2002.[CrossRef][Web of Science][Medline]
  32. Pope CA 3rd, Burnett RT, Thurston GD, Thun MJ, Calle EE, Krewski D, and Godleski JJ. Cardiovascular mortality and long-term exposure to particulate air pollution: epidemiological evidence of general pathophysiological pathways of disease. Circulation 109: 71–77, 2004.
  33. Pope CA 3rd, Thun MJ, Namboodiri MM, Dockery DW, Evans JS, Speizer FE, and Heath CW Jr. Particulate air pollution as a predictor of mortality in a prospective study of U. S. adults. Am J Respir Crit Care Med 151: 669–674, 1995.[Abstract]
  34. Pourazar J, Mudway IS, Samet JM, Helleday R, Blomberg A, Wilson SJ, Frew AJ, Kelly FJ, and Sandstrom T. Diesel exhaust activates redox-sensitive transcription factors and kinases in human airways. Am J Physiol Lung Cell Mol Physiol 289: L724–L730, 2005.[Abstract/Free Full Text]
  35. Rahman I. The role of oxidative stress in the pathogenesis of COPD: implications for therapy. Treat Respir Med 4: 175–200, 2005.[CrossRef][Medline]
  36. Reibman J, Hsu Y, Chen LC, Kumar A, Su WC, Choy W, Talbot A, and Gordon T. Size fractions of ambient particulate matter induce granulocyte macrophage colony-stimulating factor in human bronchial epithelial cells by mitogen-activated protein kinase pathways. Am J Respir Cell Mol Biol 27: 455–462, 2002.[Abstract/Free Full Text]
  37. Salvi SS, Nordenhall C, Blomberg A, Rudell B, Pourazar J, Kelly FJ, Wilson S, Sandstrom T, Holgate ST, and Frew AJ. Acute exposure to diesel exhaust increases IL-8 and GRO-alpha production in healthy human airways. Am J Respir Crit Care Med 161: 550–557, 2000.[Abstract/Free Full Text]
  38. Samet JM, Dominici F, Curriero FC, Coursac I, and Zeger SL. Fine particulate air pollution and mortality in 20 U. S. cities, 1987–1994. N Engl J Med 343: 1742–1749, 2000.[Abstract/Free Full Text]
  39. Sarnat JA, Schwartz J, and Suh HH. Fine particulate air pollution and mortality in 20 U. S. cities. N Engl J Med 344: 1253–1254, 2001.[Free Full Text]
  40. Singh SV, Srivastava SK, Choi S, Lew KL, Antonsiewicz J, Xiao D, Zeng Y, Watkins SC, Johnson CS, Trump DL, Lee YJ, Xiao H, and Herman-Antosiewicz A. Sulforaphane-induced cell death in human prostate cancer cells is initiated by reactive oxygen species. J Biol Chem 280: 19911–19924, 2005.[Abstract/Free Full Text]
  41. Singh P, DeMarini DM, Dick CA, Tabor DG, Ryan JV, Linak WP, Kobayashi T, and Gilmour MI. Sample characterization of automobile and forklift diesel exhaust particles and comparative pulmonary toxicology in mice. Environ Health Perspect 112: 820–825, 2004.[Web of Science][Medline]
  42. Suwa T, Hogg JC, Quinlan KB, Ohgami A, Vincent R, and van Eeden SF. Particulate air pollution induces progression of atherosclerosis. J Am Coll Cardiol 39: 935–942, 2002.[Abstract/Free Full Text]
  43. Swedmark S, Jernstrom B, and Jenssen D. Comparison of the mRNA sequences for Pi class glutathione transferases in different hamster species and the corresponding enzyme activities with anti-benzo[a]pyrene-7,8-dihydrodiol 9,10-epoxide. Biochem J 318: 533–538, 1996.
  44. Traka M, Gasper AV, Smith JA, Hawkey CJ, Bao Y, and Mithen RF. Transcriptome analysis of human colon Caco-2 cells exposed to sulforaphane. J Nutr 135: 1865–1872, 2005.[Abstract/Free Full Text]
  45. van Eeden SF, Tan WC, Suwa T, Mukae H, Terashima T, Fujii T, Qui D, Vincent R, and Hogg JC. Cytokines involved in the systemic inflammatory response induced by exposure to particulate matter air pollutants [PM(10)]. Am J Respir Crit Care Med 164: 826–830, 2001.[Abstract/Free Full Text]
  46. Wang M, Saxon A, and Diaz-Sanchez D. Early IL-4 production driving Th2 differentiation in a human in vivo allergic model is mast cell derived. Clin Immunol 90: 47–54, 1999.[CrossRef][Web of Science][Medline]
  47. Whitekus MJ, Li N, Zhang M, Wang M, Horwitz MA, Nelson SK, Horwitz LD, Brechun N, Diaz-Sanchez D, and Nel AE. Thiol antioxidants inhibit the adjuvant effects of aerosolized diesel exhaust particles in a murine model for ovalbumin sensitization. J Immunol 168: 2560–2567, 2002.[Abstract/Free Full Text]
  48. Ye Z and Song H. Glutathione s-transferase polymorphisms (GSTM1, GSTP1 and GSTT1) and the risk of acute leukaemia: a systematic review and meta-analysis. Eur J Cancer 41: 980–989, 2005.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 J. Appl. Physiol.Home page
M. Malaguti, C. Angeloni, N. Garatachea, M. Baldini, E. Leoncini, P. S. Collado, G. Teti, M. Falconi, J. Gonzalez-Gallego, and S. Hrelia
Sulforaphane treatment protects skeletal muscle against damage induced by exhaustive exercise in rats
J Appl Physiol, October 1, 2009; 107(4): 1028 - 1036.
[Abstract] [Full Text] [PDF]

Home page
 PediatricsHome page
F. D. Gilliland
Outdoor Air Pollution, Genetic Susceptibility, and Asthma Management: Opportunities for Intervention to Reduce the Burden of Asthma
Pediatrics, March 1, 2009; 123(Supplement_3): S168 - S173.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
Y. W. Kim, H. E. Kang, M. G. Lee, S. J. Hwang, S. C. Kim, C. H. Lee, and S. G. Kim
Liquiritigenin, a flavonoid aglycone from licorice, has a choleretic effect and the ability to induce hepatic transporters and phase-II enzymes
Am J Physiol Gastrointest Liver Physiol, February 1, 2009; 296(2): G372 - G381.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. C. Lee, F. Bhora, J. Sun, G. Cheng, E. Arguiri, C. C. Solomides, S. Chatterjee, and M. Christofidou-Solomidou
Dietary flaxseed enhances antioxidant defenses and is protective in a mouse model of lung ischemia-reperfusion injury
Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L255 - L265.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
292/1/L33    most recent
00170.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ritz, S. A.
Right arrow Articles by Diaz-Sanchez, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ritz, S. A.
Right arrow Articles by Diaz-Sanchez, D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.