| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Hart and Louise Lyon Laboratory, Division of Clinical Immunology and Allergy, Department of Medicine, UCLA David Geffen School of Medicine, University of California, Los Angeles, California
Submitted 5 May 2006 ; accepted in final form 4 August 2006
 |
ABSTRACT |
|---|
 TOP ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
from primary human bronchial epithelial cells, sulforaphane pretreatment inhibited diesel-induced production of all of these cytokines. Our studies show that sulforaphane can mitigate the effect of diesel in respiratory epithelial cells and demonstrate the chemopreventative potential of phase II enzyme enhancement. reduced nicotinamide adenine dinucleotide phosphate: quinine oxidoreductase 1; glutathione S-transferase; interleukin-8; air pollution; inflammation
Air pollution induces local inflammation in the respiratory tract (28, 37) and has been associated with a variety of adverse health effects. Epidemiological studies have shown a consistent association between exposure to high levels of ambient particulate matter and an increased incidence of morbidity and mortality due to respiratory conditions and cardiovascular events (7, 15, 18, 31–33, 38, 39). The ability of oxidant pollutants, such as diesel exhaust particles (DEPs) and ozone, to enhance inflammation has also been confirmed in both human and animal in vivo models (5, 6). This ability is thought to be due to the generation of reactive oxygen species, which can activate redox-sensitive transcription factors, thereby regulating expression of many proinflammatory cytokines, including TNF-
, IL-6, and IL-8 (14, 23, 27, 34). Indeed, stimulation with chemical extracts of DEPs causes release of these cytokines from epithelial and monocytic cells.
The consequences of oxidative stress can be deleterious to the body; consequently, vertebrates have evolved protective defense mechanisms, including the phase II enzymes (which enzymatically modify toxic chemicals, lipid peroxides, and other by-products of inflammation) as one arm of the endogenous antioxidant defenses. Sulforaphane, an isothiocyanate compound derived from cruciferous vegetables, potently upregulates the expression of these enzymes (3, 9).
In this initial study, we test the concept that induction of phase II enzymes is a potential therapeutic strategy to block the adverse effects of oxidant pollutants. We show that sulforaphane treatment induces expression of phase II enzyme in bronchial epithelial cells (BECs) and inhibits the diesel extract (DX)-induced production of proinflammatory cytokine. These data indicate that sulforaphane may be effective in preventing the proinflammatory effects of DEPs and of oxidant pollutants more generally.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
Extract of DEPs (DX) was prepared as previously described (21). Briefly, 100 mg of DEPs [generated from a light-duty four-cylinder diesel engine (4JB1 type, Isuzu Automobile) using standard fuel and provided by Dr. M. Sagai] were suspended in 25 ml of methanol and sonicated for 2 min, followed by centrifugation at 2,000 rpm for 10 min at 4°C. The supernatant was transferred to a polypropylene tube and dried under nitrogen gas, dissolved in DMSO at a concentration of 100 µg/µl, and stored in the dark at –80°C. For a detailed comparison of the chemical and physical characteristics of these DEPs, and their comparative pulmonary toxicology to the NIST standard DEPs, see Singh et al. (41).
BEC cultures. The transformed human BEC line BEAS-2B was obtained from the American Type Culture Collection (ATCC no. CRL-9609; Manassas, VA) and cultured in serum-free LHC-8 medium supplemented with retinoic acid, epinephrine, and penicillin/streptomycin (all from Biosource, Camarillo, CA). Normal human BECs (NHBECs) were obtained from Cambrex (East Rutherford, NJ) and cultured in BEGM-Bulletkit bronchial epithelial medium (Cambrex).
Cells were plated into 6- or 24-well plates and grown to 
80% confluence; for BEAS-2B cells, plates were precoated with collagen (Vitrogen, Angiotech, Palo Alto, CA), fibronectin (Calbiochem), and bovine serum albumin (Biosource). Because epinephrine has been reported to suppress cytokine expression by BECs (36), cells were washed with HEPES-buffered saline (Biosource), and fresh epinephrine-free medium was added 24 h before stimulation.
BEAS-2B and NHBECs were stimulated with 5 µM sulforaphane, or media control for 24 h, harvested, and used to determine NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutathione S-transferase (GST) M1 (GSTM1) gene expression. Stimulation with DX or vehicle (DMSO) was performed in the presence or absence of 24-h pretreatment with sulforaphane. After 24 h, supernatants were harvested for cytokine production; this time point was chosen after preliminary experimentation indicated that this was the most robust point for measurement (data not shown).
NQO1 plasmid construction, cell transfection, and Western blot. The NQO1 coding region was subcloned into pcDNA-3.1 vector. The fragment of 822 bp was amplified by the sense primer 5' GGCGAAGCTTATGGTCGGCAGAAGAGCACT 3' with Hind III site and antisense primer 5' CGGCCTCGAGTTTTCTAGCTTTGATCTG GT 3' with Xho I site. The PCR product and the pcDNA 3.1 vector were digested with restriction endonuclease enzymes Hind III and Xho I (New England Biolaboratories, Beverly, MA) at 37°C for 2 h. After the purification, the PCR product was cloned into Hind III and Xho I sites of pcDNA 3.1 vectors by using T4 DNA ligase at 16°C overnight. The positive plasmid was checked by DNA sequencing.
Human BEAS-2B cells were grown in 12-well plates in LHC-9 medium. The Lipofectamine 2000 transfection reagent kit (Invitrogen) was used to transfect the cells with pcDNA-NQO1 per manufacturer's protocol. Thirty-six hours later, the cells were collected for NQO1 protein assay by Western blot, performed as previously described. Briefly, cells were lysed, and 40 µg total protein were used for 10% SDS-PAGE and transferred to PVDF membrane, which was incubated with 1:2,000 goat anti-NQO1 antibody (Abcam, Cambridge, MA) for 1 h. After washing, the membrane was incubated with 1:5,000 horseradish peroxidase-labeled donkey anti-goat IgG (Abcam) for 1 h and detected by enhanced chemiluminescence (Amersham, Piscatway, NJ) Western blot kit. -Actin was used as an internal control. The membrane was then stripped and reblocked by 5% nonfat milk for 3 h and then incubated with 1:2,000 anti--actin antibody for 1 h followed by washing and incubation with 1:2,500 secondary antibody.
Transfected and sham-transfected cells were stimulated with DX, 36 h after transfection, at various concentrations (0, 20, 50, 100 µg/ml). The medium was collected for IL-8 assay after 24-h treatment.
Real-time quantitative PCR analysis of phase II enzyme expression.
RNA was isolated from cultured cells using TRIzol (Invitrogen), according to the manufacturer's instructions. Genomic DNA was removed using DNAse I (Gibco, Carlsbad, CA, catalog no. 18196–022), and cDNA was generated using Superscript II (Gibco, no. 18064–014) using random hexamers (Gibco). The FAM-labeled primer/probe set for NQO1 and VIC-labeled primer/probe set for -actin were obtained from Applied Biosystems (Foster City, CA). Primers for GSTM1 were obtained from Sigma-Genosys (The Woodlands, TX); the primer sequences are 5'-ATGATACTGGGGTACTGGGA for the forward primer and 5'-ATCAAGTAGGGCAGATTGGG for the reverse.
PCR was carried out in the ABI Prism 7700 Sequence Detection System under the control of Sequence Detector version 1.9 software (Applied Biosystems), using either TaqMan Universal PCR Master Mix (Applied Biosystems) or Platinum SYBRgreen qPCR SuperMix-UDG with ROX (Invitrogen). Gene expression was quantitated relative to the expression of the housekeeping gene by the 
Ct (threshold cycle) method, and expression was further normalized to background expression in untreated cells.
GST activity and cell viability. Total GST activity was measured following the use of 1-chloro-2,4-dinitrochlorobenzene (CDNB) agents using the technique of Habig et al. (13); briefly, cells were harvested and washed by PBS (pH 7.4) at 4°C. Cytosolic fractions were prepared by sonication and ultracentrifugation, as previously described (43). Activity was then followed by measuring the conjugation of 1 mM CDNB with 1 mM GSH at 37°C in 200 mM sodium phosphate buffer (pH 6.5), as measured at 340 nm using a spectrophotometer over time. Enzyme activity was expressed as millimoles of CDNB conjugated per minute per milligram of cytosolic protein. Cell viability was determined by staining with propidium iodide and apoptosis by Annexin V staining, as previously described (46).
Measurement of cytokines.
Cytokines were measured in cell culture supernatants by sandwich ELISA using BD OptEIA antibody sets for human IL-8, granulocyte-macrophage colony-stimulating factor (GM-CSF), and IL-1 (BD Biosciences, San Diego, CA), following the manufacturer's instructions. The limit of detection for these assays was 5 pg/ml.
Data analysis. Data are expressed as means ± SD, unless otherwise indicated. Statistical analysis was conducted using Systat 11. One-way ANOVA was applied to the data, and the Tukey post hoc test was used to determine statistically significant differences (P < 0.05) between groups.
|
RESULTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
|
15-fold. Treatment of NHBECs with sulforaphane also upregulated NQO1 expression, albeit to a lower extent; relative expression of NQO1 was threefold higher in treated NHBECs compared with untreated controls.
|
Sulforaphane also enhanced enzyme activity in both BEAS-2B cells and NHBECs (Table 1). GST activity in cells stimulated with sulforaphane increased in a dose-dependent fashion. No change in cell viability and no indication of apoptosis was observed at any concentration <10 µg/ml at 24 h (data not shown).
|
was detectable in supernatants from BEAS-2B cells.
|
|
|
. Detectable levels of GM-CSF and IL-1 were expressed under basal conditions (Fig. 4, B and C). Stimulation with 10 µg/ml DX marginally increased production of both GM-CSF and IL-1 over baseline; production of these cytokines was substantially enhanced upon stimulation with 25 µg/ml DX. As with IL-8, pretreatment of NHBECs with sulforaphane inhibited the production of GM-CSF and IL-1 upon stimulation with the higher dose of DX (Fig. 5, B and C). |
DISCUSSION |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
production, providing support for the potential of using a chemopreventative strategy to counteract the prooxidant effects of air pollutants. Previously, sulforaphane has been studied most extensively for its potential as an anti-carcinogenic agent. This is the first study to examine the concept that induction of phase II enzymes through chemoprevention may moderate the proinflammatory impact of oxidant pollutants such as diesel exhaust.
Airborne particulates are known to exacerbate existing respiratory and cardiovascular conditions, and there is a strong epidemiological association between episodes of poor air quality and increased morbidity and mortality. Mounting evidence indicates that particulate matter can also contribute to the development of these disorders as well, for example, accelerating the progression of atherosclerosis (19, 42) and acting as an adjuvant for the development of allergic immune responses (5, 6). As has been highlighted by us and many others, air pollutants are toxic in part due to their ability to induce oxidative stress (22, 27, 47). The generation of reactive oxygen species upon exposure to airborne pollutants causes the activation of the NF-
B and MAP kinase pathways, which transcriptionally regulate the production of proinflammatory cytokines by the airway epithelium, which, in turn, initiates a cascade of effects that result in local inflammatory responses (14, 34, 36). In addition to the exacerbation of existing airway disease, these responses may also predispose to the development of acute cardiovascular events, through the systemic spillover of cytokines and induction of the acute phase response (18). Given the central role of oxidative stress in mediating these pathways, antioxidant strategies have been identified as being potentially beneficial in the treatment and prevention of pollution-induced exacerbations of cardiorespiratory disease. In addition, oxidative stress occurs, not only as a result of exposure to airborne oxidant pollutants, but also as an outcome of inflammatory processes themselves, such as those in asthma or COPD (2, 8, 35), and augmentation of antioxidant defenses in the respiratory tract may be beneficial in such diseases as well, independently of air pollution exposure.
Sulforaphane is an isothiocyanate derived from cruciferous vegetables and is the most potent known naturally occurring inducer of the phase II enzyme genes (9). Phase II enzymes, including the GSTs, NQO1, and others, detoxify electrophiles and reactive oxygen species by several mechanisms, including mediating their conjugation with endogenous ligands that promote their excretion. We used sulforaphane in these studies because of its potency in inducting phase II enzyme expression, as well as its demonstrated tolerability in human studies. Moreover, the top concentration used by us (6.25 µM) is well within the physiologically achievable range, as indicated in studies of oral dosing with sulforaphane in rats (16), or consumption of high-glucosinolate broccoli in humans (11).
Antioxidant strategies may be especially beneficial in individuals who have reduced or absent phase II enzyme activity, such as may occur with certain genetic polymorphisms. Such mutations are very common; for example, the null polymorphism in the GST µ (GSTM1) gene, present in up to 50% of some populations (4); similarly, a nonfunctional polymorphism in the gene for NQO1 (NQO1*2) is present in 20% of Caucasians and can approach 50% in other ethnic groups (10). Although there are numerous phase II enzyme genes, and one might hypothesize that the absence of a single one of these would not have a major impact, in fact, people with GST polymorphisms have been shown to be more susceptible to the development of certain cancers (17, 25, 48) and also to be more sensitive to the adverse effect of air pollutants (12, 20). In this study, we demonstrated that sulforaphane upregulated the expression of GSTM1 and NQO1 in primary human airway epithelial cells. Although these genes were selected as markers of sulforaphane effects on phase II enzyme expression, there are doubtless many more genes involved that will likely play a role in detoxification and antioxidant defense and will likely be involved in imparting protection from oxidant pollutants. The data presented here suggest that this is indeed the case: despite the absence of a detectable change in GSTM1 gene expression in BEAS-2B cells in response to sulforaphane (Fig. 2), GST activity was clearly increased (Table 1). Moreover, although NHBECs had apparently lower induction of NQO1 gene expression compared with BEAS-2B cells (Fig. 2), sulforaphane was effective in eliciting GST activity (Table 1) and damping DX-induced cytokine expression at much lower doses in NHBECs than in BEAS-2Bs (Figs. 3 and 5). Since these genes have overlapping substrates, induction might compensate for the absence of individual gene function in individuals with null polymorphisms. Thus the potential benefits of treatments may be especially enhanced in these individuals.
However, it is important to note that, although the induction of phase II enzymes is usually considered to be beneficial, in some cases these enzymes can bioactivate several hazardous chemicals and possibly induce cell death via ROS generation (29, 40). Such an effect is not without precedent: the use of -carotene supplementation increased, rather than decreased, cancer risk in a population of smokers (1). Thus it will be important to carefully assess both the potential risks and benefits in the use of sulforaphane clinically.
We cannot categorically state that the upregulation of phase II enzymes is the sole mechanism by which sulforaphane protects from the proinflammatory effects of DX in these studies. Sulforaphane treatment can induce the expression of many different genes (44) and can have effects on cell cycle, apoptosis, the activity of histone deacetylase, and many other processes (26). However, our finding that transfection of epithelial cells with just one phase II enzyme can reduce the effects of diesel certainly suggests that phase II enzyme induction is a likely, if not unique, mechanism by which sulforaphane exerts its effects in our system.
In conclusion, we have shown that pretreatment with sulforaphane effectively limits the proinflammatory effects of DX on airway epithelial cells, concomitant with an upregulation of key phase II enzyme genes. While it still needs to be demonstrated that this will be similarly effective and safe in vivo, these results support the potential use of sulforaphane-based strategies to limit pollution-induced local inflammatory responses, which could prevent exacerbations of asthma or COPD, or the induction of cardiovascular events, particularly in susceptible individuals.
|
GRANTS |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
Present address of S. A. Ritz: Northern Ontario School of Medicine, East Campus, Laurentian University, 935 Ramsey Lake Rd., Sudbury ON, P3E 2C6, Canada.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
|
REFERENCES |
|---|
|
TOPABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONGRANTSREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. C. Lee, F. Bhora, J. Sun, G. Cheng, E. Arguiri, C. C. Solomides, S. Chatterjee, and M. Christofidou-Solomidou Dietary flaxseed enhances antioxidant defenses and is protective in a mouse model of lung ischemia-reperfusion injury Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L255 - L265. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |
, Control-transfected cells; 
, pcDNA-NQO1-transfected cells. Data are shown as means ± SD (n = 4). *Statistically significant difference (P < 0.05) compared with control cells at same DX dose.
), 10 µg/ml (
), or vehicle only (0.25% DMSO) (
Significant reduction in IL-8 production (P < 0.05) compared with the 0 sulforaphane control at the same DX dose.
) or 25 µg/ml (
). Data are shown as means ± SD (n = 3) of one representative experiment. *Significant increase in cytokine production (P < 0.05) from the 0 DX control at same sulforaphane dose.