Am J Physiol Lung Cell Mol Physiol 292: L1361-L1369, 2007.
First published February 23, 2007; doi:10.1152/ajplung.00279.2006
1040-0605/07 $8.00
Asbestos-mediated CREB phosphorylation is regulated by protein kinase A and extracellular signal-regulated kinases 1/2
Christy A. Barlow,1
Trisha F. Barrett,2
Arti Shukla,2
Brooke T. Mossman,2 and
Karen M. Lounsbury1
Departments of 1Pharmacology and 2Pathology, University of Vermont, Burlington, Vermont
Submitted 24 July 2006
; accepted in final form 9 February 2007
 |
ABSTRACT
|
|---|
Asbestos is a ubiquitous, naturally occurring fiber that has been linked to the development of malignant and fibrotic lung diseases. Asbestos exposure leads to apoptosis, followed by compensatory proliferation, yet many of the signaling cascades coupled to these outcomes are unclear. Because CREs (Ca2+/cAMP-response elements) are found in the promoters of many genes important for regulation of proliferation and apoptosis, CREB (CRE binding protein) is likely to play an important role in the development of asbestos-mediated lung injury. To explore this possibility, we tested the hypotheses that asbestos exposure leads to CREB phosphorylation in lung epithelial cells and that protein kinase A (PKA) and extracellular signal-regulated kinases 1/2 (ERK1/2) are central regulators of the CREB pathway. Persistent CREB phosphorylation was observed in lung sections from mice following inhalation of crocidolite asbestos. Exposure of C10 lung epithelial cells to crocidolite asbestos led to rapid CREB phosphorylation and apoptosis that was decreased by the inhibition of PKA or ERK1/2 using the specific inhibitors H89 and U0126, respectively. Furthermore, crocidolite asbestos selectively induced a sustained increase in MAP kinase phosphatase-1 mRNA and protein. Silencing CREB protein dramatically reduced asbestos-mediated ERK1/2 phosphorylation, yet significantly increased the number of cells undergoing asbestos-induced apoptosis. These data reveal a novel and selective role for CREB in asbestos-mediated signaling through pathways regulated by PKA and ERK1/2, further providing evidence that CREB is an important regulator of apoptosis in asbestos-induced responses of lung epithelial cells.
pulmonary fibrosis; signal transduction; small interfering RNA; mitogen-activated protein kinase phosphatase-1
ASBESTOS IS A GROUP of naturally occurring mineral fibers associated with the development of lung cancer and fibrosis (15). Iron-containing asbestos fibers, such as crocidolite asbestos, can catalyze the formation of reactive oxygen species (ROS) through iron-dependent reactions occurring on the fiber surface and through frustrated phagocytosis of longer fibers (>8 µm) (31, 32). The production of ROS caused by asbestos is believed to be integral to the pathogenesis of fibrotic lung disease and cancers (15).
Asbestos stimulates phosphorylation of extracellular signal-regulated kinases 1/2 (ERK1/2) at least partly through an oxidant-dependent pathway that is believed to be integral to pathological signaling in lung epithelium (3, 8, 41). Upon phosphorylation, ERK1/2 can translocate to the nucleus where it induces c-fos and c-jun, leading to the activation of transcription factors intrinsic to proliferation and apoptosis (9). Others have reported that ERK1/2 mediates the actions of both Ca2+ and growth factors, resulting in activation of the Ca2+/cAMP-response element binding protein (CREB) (30).
CREB is a 43-kDa transcription factor belonging to the basic leucine zipper family (11, 30). CREB is activated upon phosphorylation of a serine at position 133 (Ser133). Phosphorylation, in turn, initiates the recruitment of cofactors to the Ca2+/cAMP-response element (CRE), such as CREB binding protein (CBP300), that are necessary for transcriptional activation (14). A diverse array of stimuli can activate a variety of pathways resulting in CREB phosphorylation and subsequent activation of gene transcription. The identified signaling cascades responsible for CREB activation include protein kinase A (PKA), PKC, Ca2+/calmodulin-dependent kinase, ERK1/2-stimulated mitogen- and stress-activated protein kinase, and p90 ribosomal S6 kinase (27, 30).
CREB activation is regulated by the second messengers, Ca2+ and cAMP. These two second messengers have been shown to regulate both ERK1/2- and PKA-mediated CREB phosphorylation (1, 26, 37). Recent studies have provided evidence that the ERK1/2 and PKA pathways cooperatively regulate the expression and function of the CRE-regulated MAPK phosphatase-1 (MKP-1) (23), a dual-specificity phosphatase involved in the direct downregulation of ERK1/2 signaling (10). However, even though CREB has the capacity to regulate multiple gene targets (14), there is little information regarding the role of Ca2+- and cAMP-mediated transcription in asbestos-induced signaling pathways and gene expression in lung epithelial cells.
We have previously shown that exposure to hydrogen peroxide (H2O2) results in CREB activation that is partially dependent on ERK1/2 phosphorylation and important in the regulation of apoptosis (1). Because of known cross talk between PKA, ERK1/2, and CREB in many cell types, the goal of this study was to determine their relative importance in asbestos-induced signaling. We tested the hypothesis that PKA and ERK1/2 are the central regulators of crocidolite asbestos-induced CREB activation in lung epithelial cells. Here, we demonstrate elevated CREB phosphorylation in both bronchiolar cells after inhalation of asbestos and in cultured C10 lung epithelial cells after exposure to crocidolite asbestos. Furthermore, we show that asbestos activates CREB through PKA and ERK1/2 and plays a role in regulating asbestos-induced apoptosis.
 |
EXPERIMENTAL PROCEDURES
|
|---|
In vivo inhalation exposures.
Experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication 85-23, 1985), and this study was approved by the University of Vermont Institutional Animal Care and Use Committee. C57Bl/6 mice (8 to 12 wk of age) were exposed to ambient air or crocidolite asbestos (7 mg/m3 air, 6 h/day, 5 days/wk), followed by harvesting of lung tissue as described previously (12). Briefly, mice were euthanized using pentobarbital (Abbott Laboratories, Abbott Park, IL), and the lungs were instilled with PBS. Left and right lobes were separated by suturing, fixed in formalin, and embedded in paraffin.
Immunofluorescence in paraffin-embedded lung sections.
Eight-micrometer-thick sections of paraffin-embedded lungs were deparaffinized in xylene and then rehydrated in graded alcohols. Sections underwent antigen retrieval in 1x Dako Antigen Retrieval Solution (Cambridge, UK) for 40 min at 95°C. Sections were permeabilized in 0.1% Triton X-100 in PBS for 10 min at room temperature (RT), washed in PBS, and then incubated with a blocking solution containing 3% goat serum for 1 h at RT. After aspiration of blocking solution, primary antibody (1:200; rabbit polyclonal phospho-CREB; Cell Signaling Technologies, Danvers, MA) diluted in 2% BSA plus 0.1% Triton X-100 in PBS (BSA/PBS-T) was added, and sections were incubated overnight at 4°C. Sections were then washed in PBS, and secondary antibody (1:400, Alexa Fluor 568 goat-anti-rabbit IgG; Molecular Probes, Carlsbad, CA) diluted in BSA/PBS-T was applied for 1 h at RT. Sections were washed in PBS, followed by incubation with nuclear counterstain, YOYO-1 iodide (1:10,000; Molecular Probes), 1 U/ml RNase, and 0.1% sodium azide in BSA/PBS-T for 30 min at RT. After being washed in PBS, coverslips were mounted onto slides with AquaPolyMount (Polysciences, Warrington, PA). For each section, confocal images were collected in fluorescence modes using a Bio-Rad MRC1024ES confocal scanning laser microscope (Hercules, CA).
Cell culture and treatment.
C10 cells, a contact-inhibited, nontransformed murine alveolar type II epithelial cell line (13), were grown in CMRL 1066 medium supplemented with L-glutamine, penicillin/streptomycin, and 10% FBS (GIBCO BRL, Rockville, MD). Cells were grown to 90% confluence, and then complete medium was replaced with CMRL 1066 medium supplemented with L-glutamine, penicillin/streptomycin, and 0.5% FBS for 48 h before exposure to agents.
Crocidolite [Na2(Fe3+)2(Fe2+)3Si8O22(OH)2(±Mg)] and chrysotile [(Mg)6(OH)8Si4O10(±Fe)] asbestos fibers (National Institute of Environmental Health Sciences reference sample) were suspended in HBSS (GIBCO BRL) at a concentration of 1 mg/ml, sonicated, triturated 10x through a 22-gauge needle to obtain a homogenous suspension, and then added directly to the medium at a final concentration of 5 µg/cm2 of culture dish surface area for the times indicated (12). Glass beads (14 µm; Particle Information Services, Kingston, WA), used as a nontoxic control particle, were suspended in HBSS at a concentration of 1 mg/ml, sonicated, and added directly to medium at a final concentration of 5 µg/cm2 for the times indicated. Forskolin and EGF (10 µM for 10 min and 100 ng/ml for 5 min, respectively; Sigma, St. Louis, MO) were used as positive controls for induction of phospho-CREB and phospho-EGF receptor (phospho-EGFR), respectively. Control cultures received medium without agents and were treated identically.
The ERK1/2 inhibitor U0126 (10 µM for 30 min before treatment) and the EGFR inhibitor AG-1478 (10 µM for 1 h before treatment) were obtained from Calbiochem (La Jolla, CA). The PKA inhibitor H89 (10 µM for 1 h before treatment) was obtained from Biomol (Plymouth Meeting, PA). All experiments were performed in triplicate.
Transient transfections with small interfering RNA.
The siControl nontargeting small interfering RNA (siRNA) #2 and SMARTpool mouse CREB siRNA (50 µM; Dharmacon, Lafayette, CO) were transfected into cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. CREB knockdown was determined by Western blot analysis after 48 h.
Immunofluorescence techniques in C10 cells.
C10 cells were grown on glass coverslips for all experiments. After experimental exposures, immunofluorescence to detect phospho-CREB was performed as previously described (1, 36). Briefly, cells were washed with PBS, fixed in 3.7% formaldehyde, permeabilized with 20°C methanol, and incubated with blocking solution containing 2% BSA in PBS. Cells were incubated with primary antibody (rabbit polyclonal phospho-CREB; Cell Signaling Technologies, 1:200) diluted in BSA/PBS-T overnight at 4°C. Secondary antibody (Alexa Fluor 568 goat-anti-rabbit IgG; Molecular Probes, 1:400) diluted in BSA/PBS-T was applied for 1 h at RT, and nuclear counterstain was applied as described above. Coverslips were mounted onto slides with AquaPolyMount (Polysciences, Warrington, PA). For each sample, confocal images were collected in fluorescence modes as described above.
Western blot analyses.
After C10 cells were exposed to agents as described above, the medium was aspirated, and the cells were washed twice with cold PBS and collected in 4x sample buffer (200 µM Tris, pH 6.8, 4% SDS, 4 mg/ml bromophenol blue, 0.04% 2-mercaptoethanol, 40% glycerol, 2 µM pyronin-Y). The amount of protein in each sample was determined using the RC/DC protein assay (Bio-Rad, Hercules, CA). Sixty micrograms of protein was separated by 10% SDS-PAGE and transferred to nitrocellulose. Western blots were performed as described previously (1), using antibodies specific to total and phosphorylated CREB (rabbit polyclonal anti-CREB, Cell Signaling Technologies, 1:1,000; rabbit polyclonal anti-phospho-CREB, Cell Signaling Technologies, 1:500), total and phosphorylated ERK1/2 (rabbit polyclonal anti-ERK1/2, Cell Signaling Technologies, 1:1,000; rabbit polyclonal anti-phospho-ERK1/2, Cell Signaling Technologies, 1:500), phospho-PKA substrate antibody (rabbit monoclonal anti-phospho-PKA substrate, RRXS*/T*, Cell Signaling Technologies, 1:5,000), MKP-1 (rabbit polyclonal anti-MKP-1, Santa Cruz, 1:1,000), MKP-3 (rabbit polyclonal anti-MKP-3, Santa Cruz, 1:1,000), and
-actin (mouse monoclonal
-actin, Abcam, Cambridge, MA, 1:2,000). Antibody binding was detected using HRP-conjugated anti-rabbit secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA, 1:5,000) or HRP-conjugated anti-mouse secondary antibody (Amersham Biosciences, Piscataway, NJ, 1:3,000), followed by chemiluminescence (Kirkgaard and Perry Laboratories, Gaithersburg, MD). QuantityOne (Bio-Rad) was used to quantify band density and was normalized to total protein.
Quantitative RT-PCR.
Total RNA was extracted with TRIzol reagent and chloroform, precipitated with isopropanol, washed with 75% ethanol, and then dissolved in RNase free water. Isolated RNA was then DNase treated (Qiagen, Valencia, CA) and cleaned using a Qiagen RNeasy kit. RNA was quantified using the NanoDrop spectrophotometer (34).
One microgram of RNA was reverse-transcribed using a Promega reverse transcription kit (Madison, WI). A probe and primer set was used to detect mkp-1 (probe: CGGCTTCCTGCCCTGAGCTGTGC; sense primer: TTCTCCAAGGAGGATATGAAGCG; antisense primer: CCGGATTCTGCACTGTCAGG). PCR products were detected by TaqMan Real Time RT-PCR, as previously described (22), using hprt as the internal standard. Standard curves were produced to compare the quantity of mRNA between mkp-1 and hprt for data analysis.
Detection and quantitation of apoptosis.
Detection of apoptosis was performed as previously described (33). Briefly, cell monolayers grown on glass coverslips were treated with crocidolite asbestos for 24 h, fixed in methanol for 24 h at 20°C, boiled for 5 min in PBS containing 5 mM MgCl2, and then immersed in ice-cold PBS for 10 min. Cells were blocked with 40% FBS and then incubated with Apostain F7-26 (10 µg/ml; Alexis Biochemicals, San Diego, CA) followed by HRP-conjugated secondary antibody (1:400, goat anti-mouse IgM; Jackson Laboratories, West Grove, PA). To visualize secondary antibody binding, the peroxidase substrate DAB (Sigma) was used. Coverslips were mounted onto slides with AquaPolyMount (Polysciences) for subsequent examination using bright field light microscopy. To determine the numbers of apoptotic cells and total cell numbers per field, five random fields were evaluated per experimental condition at x400 magnification on duplicate coverslips.
Statistical analysis.
Differences between treatment groups were assessed by one-way analysis of variance or Student's t-test where indicated. The analyses were based on nonnormalized data, and pairwise comparisons between treatment groups were performed using the Holm Sidak method. Differences were considered statistically significant at P < 0.05.
 |
RESULTS
|
|---|
Asbestos inhalation results in an increase in CREB phosphorylation in bronchiolar epithelial cells.
To support a pathophysiological role for CREB in asbestos-mediated lung injury, a murine model of asbestosis after inhalation of crocidolite asbestos was used to detect patterns of CREB activation in bronchiolar epithelial cells. Lungs from sham and asbestos-exposed animals were examined over a time frame corresponding to the development of peak epithelial cell proliferation (3 days) and fibrosis (30 days) (6). Nuclear phospho-CREB levels were dramatically elevated, primarily in bronchiolar epithelial cells exposed to crocidolite asbestos for 4 days, a time point associated with proliferation, and 30 days, a time point associated with fibrosis (Fig. 1A). CREB phosphorylation was particularly prominent in areas developing peribronchiolar fibrotic lesions observed at the 30-day time point.

View larger version (86K):
[in this window]
[in a new window]
|
Fig. 1. Crocidolite asbestos exposure leads to rapid and prolonged Ca2+/cAMP-response element binding protein (CREB) phosphorylation in both bronchiolar and C10 lung epithelial cells. A: C57Bl/6 mice were exposed to ambient air or crocidolite asbestos (7 mg/m3 air; 6 h/day; 5 days a wk) for 4 or 30 days, and lungs were preserved and sectioned as described in EXPERIMENTAL PROCEDURES. Phospho-CREB (red) was detected by immunofluorescence in paraffin sections. Nuclei were stained with YOYO-1 (green). Colocalization of signals is represented in white. B: phospho-CREB (red) was detected by immunofluorescence after C10 cells were exposed to 5 µg/cm2 of crocidolite asbestos (Croc) for the indicated time points. Asbestos fibers are blue.
|
|
Crocidolite asbestos stimulates CREB phosphorylation in C10 lung epithelial cells.
To investigate mechanisms underlying asbestos-mediated signaling through phosphorylation of CREB, CREB activation was assessed following exposure of C10 cells to crocidolite or chrysotile asbestos. Crocidolite asbestos exposure (5 µg/cm2) led to focal increases in phospho-CREB-positive cells as detected by immunofluorescence at the site of fiber deposition (Fig. 1B). Crocidolite asbestos stimulated a significant increase in the phosphorylation of CREB after 2, 4, 8, and 24 h of exposure (Fig. 2). Although the magnesium-containing, serpentine fiber chrysotile did not induce a significant increase in CREB phosphorylation, there was a definite trend toward increased CREB phosphorylation at later time points. Glass beads (data not shown) did not stimulate CREB phosphorylation. Together, these data suggest that asbestos fiber composition and shape are important in the timing and level of the CREB response.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 2. Exposure to crocidolite and not chrysotile asbestos leads to phosphorylation of CREB in a time-dependent manner in C10 lung epithelial cells. Levels of phospho-CREB (p-CREB) were determined using Western blot analysis after C10 cells were treated with 5 µg/cm2 of crocidolite or chrysotile asbestos for the indicated time points. The graph represents data normalized to the control response. Refer to Table 1 for quantified data.
|
|
Crocidolite asbestos-induced CREB phosphorylation is regulated by both the ERK1/2 and PKA pathways.
Pretreatment of cells with the MEK1/2 inhibitor, U0126, led to a decrease in CREB phosphorylation in response to crocidolite asbestos compared with the DMSO vehicle control (Fig. 3A and Table 1), indicating a role for ERK1/2 in the asbestos-mediated response. In the presence of the EGFR inhibitor, AG-1478, asbestos-induced CREB activation was inhibited only at early time points (Fig. 3B and Table 1), suggesting an early role for EGFR in crocidolite asbestos-induced CREB activation. Furthermore, forskolin-induced CREB phosphorylation was inhibited by the reduction of EGFR activity with AG-1478 (159.82 ± 35.50 vs. 17.01 ± 13.81; n = 3) (data not shown), suggesting that PKA may contribute to EGFR-meditated CREB phosphorylation.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 3. Reduction of EGF receptor (EGFR) and extracellular signal-regulated kinases 1/2 (ERK1/2) activity decrease crocidolite asbestos-mediated CREB activation. A: C10 cells, preincubated with 10 µM U0126 for 30 min, were treated with 10 µM forskolin for 10 min or 5 µg/cm2 crocidolite asbestos at the indicated time points and then analyzed by Western blot for p-CREB, total CREB, and phospho-ERK1/2 (p-ERK1/2). Phosphorylated activating transcription factor (p-ATF) is a CREB family member that is recognized by the p-CREB antibody and closely correlates with CREB. B: C10 cells were preincubated with 10 µM AG-1478 for 1 h and then treated with 200 µM H2O2 for 10 min or 100 ng/ml EGF for 5 min or 5 µg/cm2 crocidolite asbestos at the indicated time points. p-CREB was then detected by Western blot analysis. An antibody recognizing total CREB was used as a control for protein loading in A and B. Refer to Table 1 for quantified data.
|
|
Using an antibody that recognizes phospho-PKA substrates, we observed that short exposure to crocidolite asbestos generated a phospho-substrate pattern similar to forskolin-treated cells (Fig. 4A). To determine the contributions of PKA in the observed asbestos-induced CREB phosphorylation, cells were evaluated with or without pretreatment with the PKA inhibitor, H89. Pretreatment of the cells with H89 substantially reduced the crocidolite asbestos-mediated CREB phosphorylation (Fig. 4B and Table 1). Because recent studies have shown that PKA regulates the ERK1/2 pathway through Raf-1 (5, 7), the role of PKA in the activation of ERK1/2 was examined. Inhibition of PKA activity did not affect crocidolite asbestos-induced ERK1/2 phosphorylation (Fig. 4B). However, treatment with forskolin led to the phosphorylation of ERK1/2 that was sensitive to H89 (59.06 ± 8.22 vs. 13.77 ± 9.04; n = 3) (Fig. 4B), demonstrating a link between PKA and ERK1/2. Together, these data suggest a significant role for both PKA and ERK1/2 in crocidolite asbestos-induced CREB activation.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 4. Inhibition of PKA reduces asbestos-induced CREB but not ERK1/2 phosphorylation. A: C10 cells were treated with 10 µM forskolin for 10 min or 5 µg/cm2 crocidolite asbestos at the indicated time points and then analyzed by Western blot analysis with the phospho-PKA substrate antibody. An antibody recognizing -actin (Actin) was used as a control for protein loading. B: C10 cells, preincubated with 10 µM H89 for 1 h, were treated with 10 µM forskolin for 10 min or 5 µg/cm2 crocidolite asbestos at the indicated time points and then analyzed by Western blot analysis for p-CREB, total CREB, p-ERK1/2, and total ERK1/2. Refer to Table 1 for quantified data.
|
|
Reduction of PKA and ERK1/2 activity reduces the number of cells undergoing apoptosis after asbestos exposure.
We have previously shown that crocidolite asbestos induces a significant increase in the percentage of cells undergoing apoptosis (3). To determine whether activation of the PKA and ERK1/2 signaling pathways are essential for asbestos-induced apoptosis, C10 cells pretreated with either H89 or U0126 were exposed to crocidolite asbestos, and apoptotic cells were identified by Apostain. Both H89 and U0126 significantly suppressed crocidolite asbestos-induced apoptosis compared with asbestos-treated vehicle control cells (22.08% ± 3.80 vs. 12.97% ± 2.97 and 14.24% ± 3.45, respectively, P < 0.001, n = 3) (Fig. 5). These data suggest that the activation of PKA and ERK1/2 is important for the onset of asbestos-induced apoptosis.

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 5. Inhibition of PKA and ERK1/2 significantly decreases the number of cells undergoing apoptosis after exposure to crocidolite asbestos. A: C10 cells, preincubated with 10 µM H89 or 10 µM U0126 for 1 h, were treated with 5 µg/cm2 crocidolite asbestos for 24 h and analyzed by bright field microscopy using an antibody specific for single-stranded DNA (Apostain). B: quantification of percent apoptosis (number Apostain-positive cells/total cells) in response to crocidolite asbestos. *P < 0.001 compared with DMSO control. #P < 0.001 compared with DMSO asbestos.
|
|
Crocidolite asbestos exposure leads to upregulation of MKP-1.
Because of interactions between CREB and ERK1/2, the role of the CRE-regulated MAPK phosphatase, MKP-1, in the regulation of crocidolite-induced cell signaling was examined. Crocidolite asbestos led to a significant increase in mkp-1 mRNA levels after 2, 4, and 8 h of exposure (Fig. 6A). A corresponding increase in MKP-1 protein level was also detected in response to asbestos exposure, which was selective to the extent that there was no effect on another MAPK phosphatase, MKP-3 (Fig. 6B).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6. MAPK phosphatase-1 (MKP-1) is upregulated after exposure to asbestos. C10 cells were treated with 10 µM forskolin for 10 min or 5 µg/cm2 crocidolite asbestos at the indicated time points and then analyzed by quantitative RT-PCR for mkp-1 (A) and Western blot analysis for MKP-1 and MKP-3 (B). An antibody recognizing -actin was used as a control for protein loading in B.
|
|
Since our data indicate that transcription of mkp-1 is upregulated in response to crocidolite asbestos exposure, we further investigated the role of CREB in the regulation of asbestos-stimulated mkp-1 induction. siRNA specifically targeting mouse CREB1 transcript (siCREB) was utilized to suppress CREB expression. Scrambled siRNA, nonspecific to any known mouse genes (siControl), was used as a control. Transfection of C10 cells with siCREB, but not siControl, suppressed basal levels of CREB expression (Fig. 7A). Surprisingly, knockdown of CREB expression did not affect crocidolite asbestos-induced mkp-1 induction (Fig. 7B). However, knockdown of CREB resulted in a dramatic decrease in crocidolite-stimulated ERK1/2 phosphorylation (Fig. 7C). These results suggest that although induction of CREB expression may not be necessary for transcription of mkp-1, it is an important regulator of the ERK1/2 pathway.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 7. Knockdown of CREB expression results in the inhibition of crocidolite asbestos-induced ERK1/2 phosphorylation, but does not affect transcription of mkp-1. A: C10 cells transiently transfected with small interfering RNA (siRNA) specifically targeting mouse CREB1 transcript (siCREB) or with a nonspecific scrambled siRNA (siControl) were analyzed by Western blot analysis for total CREB and -actin. B: C10 cells transiently transfected with siControl or siCREB were treated with 5 µg/cm2 crocidolite asbestos at the indicated time points and then analyzed by quantitative RT-PCR for mkp-1. C: C10 cells transiently transfected with siControl or siCREB were treated with 5 µg/cm2 crocidolite asbestos at the indicated time points and then analyzed by Western blot analysis for p-ERK1/2 and total ERK1/2.
|
|
Reduction of CREB activity significantly increases the number of cells undergoing apoptosis after asbestos exposure.
To determine whether CREB is the specific downstream mediator of ERK1/2- and PKA-induced apoptosis in response to asbestos, CREB was selectively removed in C10 cells using siCREB, and apoptotic cells were identified by Apostain. Unlike the results with inhibitors of ERK1/2 and PKA, siCREB did not inhibit apoptosis mediated by crocidolite asbestos (Fig. 8, A and B). Moreover, siCREB cells exposed to asbestos had significantly higher levels of apoptosis than the siControl cells exposed to asbestos (15.40% ± 1.78 vs. 28.40% ± 4.15, P < 0.001, n = 3) (Fig. 8, A and B), supporting a selective role for CREB in the regulation of apoptosis induced by asbestos.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 8. Knockdown of CREB expression significantly increases the number of cells undergoing apoptosis after exposure to crocidolite asbestos. A: C10 cells transfected with siControl or siCREB were treated with crocidolite asbestos for 24 h and analyzed by bright field microscopy using an antibody specific for single-stranded DNA (Apostain). B: quantification of percent apoptosis (number Apostain-positive cells/total cells) in response to crocidolite asbestos. *P < 0.001 compared with untreated siControl. #P < 0.001 compared with asbestos-exposed siControl.
|
|
 |
DISCUSSION
|
|---|
Asbestos fibers play an important role in the pathogenesis of many occupational lung diseases, including asbestosis, pleural plaques, and lung cancer (15). However, the cell signaling mechanisms involved in the pathogenesis of these diseases are not clearly understood. Here, we first demonstrate that PKA activity is important to asbestos signaling mechanisms by showing a link between crocidolite asbestos-mediated activation of PKA, ERK1/2, and the CREB transcription factor in lung epithelial cells. Furthermore, we show that in vivo lung injury by crocidolite asbestos leads to rapid and prolonged phosphorylation of CREB in bronchiolar epithelium.
The average concentration of asbestos (7 mg/m3 air) used in our inhalation studies is similar to concentrations of airborne asbestos used in past workplace settings before the development of occupational safety standards and giving rise to lung diseases in humans (Health Effects Institute, Asbestos Research, Panel Report on Asbestos in Public and Commercial Buildings, Cambridge, MA, 1991). It is difficult to determine how in vitro concentrations of asbestos relate to human exposures over time, but concentrations and time points of asbestos used here have been previously characterized to result in both apoptosis and compensatory cell proliferation (3).
Numerous studies from our group have shown that crocidolite asbestos fibers trigger multiple signaling cascades, including MAPKs and NF-
B (16, 24). Recent research suggests that the generation of oxidants during the phagocytic burst and frustrated phagocytosis of long fibers may be responsible for the initiation of cell signaling (15). Alternatively, asbestos fibers may interact with receptors triggering cell signaling pathways through metals that cause aggregation and phosphorylation of these receptors (18, 42). Jimenez et al. (8) have shown crocidolite asbestos-induced ERK1/2 phosphorylation in rat pleural mesothelial cells that is partially inhibited in response to the antioxidants catalase and N-acetyl-cysteine and by chelation of surface iron from the fibers.
Crocidolite asbestos has the capacity to activate several signaling pathways that may communicate with CREB. We have previously demonstrated that ERK1/2 is persistently phosphorylated in response to crocidolite asbestos in lung epithelial cells (3, 40). Here, we show that crocidolite asbestos-mediated ERK1/2 activation is partially responsible for crocidolite asbestos-induced CREB phosphorylation. The Ras/ERK1/2 pathway has been shown to be regulated through PKA and its regulation of the serine/threonine kinases Raf-1 and B-Raf (5, 7). Although PKA is partially responsible for crocidolite asbestos-induced CREB phosphorylation, PKA does not regulate the ERK1/2 pathway, indicating that PKA and ERK1/2 are acting independently in response to crocidolite asbestos.
Many studies have suggested a functional involvement of PKA in the mitogenic signals transmitted through the EGFR. An increase in cAMP levels causes tyrosine phosphorylation of the EGFR in many, but not all, cell types (19, 20). Moreover, the tyrosine kinase activity of EGFR is required for growth factor stimulation of adenylyl cyclase activity, which leads to the activation of PKA (17, 21). In our study, we found that CREB phosphorylation following crocidolite asbestos exposure was reduced by inhibiting PKA and EGFR activity. Moreover, forskolin-induced CREB phosphorylation was inhibited by the reduction of EGFR activity. Together, these data suggest that PKA is downstream of EGFR and may be an important regulator of CREB through the ERK1/2 signaling pathway in lung epithelial cells responding to crocidolite asbestos.
The dual-specificity phosphatase, MKP-1, is involved in the direct downregulation of MAPK signaling by dephosphorylating both Thr and Tyr residues within their consensus sequence (10). MKP-1 is regulated at the transcription level by two CRE sites in its promoter region (35), indicating that CREB may play a feedback role in fine-tuning ERK1/2 signaling. PKA and Ca2+, the potent activators of CREB, both contribute to the activation of mkp-1 (4, 29, 35). In this study, we show that mkp-1 induction is significantly increased in response to crocidolite asbestos at time points corresponding to CREB phosphorylation. However, knockdown of CREB expression does not affect mkp-1 induction. Similar to our findings, Ryser et al. (28) showed that the transactivation of the MKP-1 promoter in thryotropin-releasing hormone-stimulated neuroendocrine cells is not correlated with an increase in recruitment of CREB or CBP compared with unstimulated cells. Together, these data suggest that CREB activation by asbestos parallels induction of mkp-1, but other CREB-related transcription factors may also be involved in regulating the activation of mkp-1 induction.
In addition to transcriptional regulation, growth factor signals regulate MKP-1 at the protein level. Recent studies have shown that MKP-1 is a substrate for ERK1/2 phosphorylation, which serves to reduce ubiquitin-dependent degradation of MKP-1 (2). Furthermore, Pursiheimo et al. (23) provided evidence that the ERK1/2 pathway and PKA cooperatively regulate the expression and function of MKP-1 protein. Here, we show that total MKP-1 and phosphorylated ERK1/2 are increased simultaneously in response to crocidolite asbestos, indicating that MKP-1 protein expression is not enough to downregulate ERK1/2 activation in response to crocidolite asbestos. However, knockdown of CREB expression significantly reduced ERK1/2 phosphorylation in response to crocidolite asbestos, suggesting that CREB-stimulated transcription leads to induction of genes involved in the regulation of ERK1/2 pathway in response to crocidolite asbestos.
We have previously demonstrated that exposure to crocidolite asbestos causes a striking increase in apoptosis in lung epithelial cells that is followed by compensatory cell proliferation (3). Our current findings implicate an important role for CREB in crocidolite asbestos-induced apoptosis. We show that inhibition of the CREB-activating kinases, PKA and ERK1/2, significantly decreases asbestos-induced apoptosis. Our findings are similar to that of another group that has shown that inhibition of PKA activity with H89 suppressed transforming growth factor-
1-induced apoptosis (39). Moreover, data from Upadhyay et al. (38) show that the loss of ERK1/2 activity increases amosite asbestos-induced apoptosis in A549 human alveolar epithelial cells. It is clear that the regulation of apoptosis by ERK1/2 and PKA is complex and may be differentially regulated by fiber composition and dose of insult. In contrast to our inhibitor studies, specific knockdown of CREB expression increases sensitivity to asbestos-mediated apoptosis in lung epithelial cells. The knockdown results are in line with findings in both neurons and vascular smooth muscle cells where reduction of CREB activity induces apoptosis, which can be rescued by overexpression of Bcl-2 (14, 25). However, these data differ from our inhibitor studies and previous studies where expression of dominant negative CREB (CREB133) was shown to reduce apoptosis following oxidant exposure (1). Possible reasons for the discrepancies are 1) the knockdown with siCREB results in loss of CREB, whereas the CREB133 competes at the level of chromatin activity, 2) the inhibition PKA and ERK1/2 not only inhibits the ability of these kinases to activate CREB but also inhibits cross talk with other pathways, and 3) differences between oxidants and asbestos induced responses in that asbestos may activate CREB through pathways that are both oxidant dependent and independent resulting in a different physiological outcome. Likewise, the differences in physiological outcome could explain the incomplete effect of oxidant scavengers of crocidolite asbestos-stimulated ERK1/2 activation (8).
In summary, our data show that responses of lung epithelial cells to crocidolite asbestos in vivo and in vitro lead to rapid and prolonged phosphorylation of CREB. Furthermore, we show an intricate signaling cascade that involves signaling through PKA- and ERK1/2-dependent activation of CREB that potentially leads to negative feedback regulation through MKP-1 induction (Fig. 9). This mechanism may be involved in the maintenance of a physiologically relevant level of ERK1/2 activity after crocidolite asbestos exposure, thus functioning as a backup mechanism to ensure a proper response in target cells. Together, our data indicate that cross talk between PKA, ERK1/2, and CREB is likely to play an important role in the development of fibrosis related to asbestos-mediated lung injury.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 9. Schematic of proposed mechanism of asbestos-induced CREB activation and regulation. Upon exposure to crocidolite asbestos, both the PKA and ERK1/2 pathways are activated, subsequently resulting in the phosphorylation of CREB. Upon phosphorylation, CREB dimerizes and binds to the Ca2+/cAMP-response element (CRE), resulting in CRE-mediated transcription of genes including mkp-1. There is a possible feedback mechanism with MKP-1 regulating ERK1/2 activation.
|
|
 |
GRANTS
|
|---|
This work was supported by National Heart, Lung, and Blood Institute Grant PO1-HL-67004. C. A. Barlow was supported by Environmental Pathology Training Grant National Institute of Environmental Health Sciences T3207122.
Present address of C. A. Barlow: Department of Pharmacology, University of Wisconsin, Madison, WI.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Douglas Taatjes, University of Vermont Cell Imaging and Analysis Core, for technical assistance, Scott Tighe and Timothy Hunter from the Vermont Cancer Center DNA Analysis Facility for expert assistance in performing quantitative RT-PCR, and Pamela Vacek for statistical support.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: K. M. Lounsbury, Univ. of Vermont, Dept. of Pharmacology, 89 Beaumont Ave., Burlington, VT 05405 (e-mail: Karen.Lounsbury{at}uvm.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Barlow CA, Shukla A, Mossman BT, Lounsbury KM. Oxidant-mediated cAMP response element binding protein activation: calcium regulation and role in apoptosis of lung epithelial cells. Am J Respir Cell Mol Biol 34: 714, 2006.[Abstract/Free Full Text]
- Brondello JM, Pouyssegur J, McKenzie FR. Reduced MAP kinase phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation. Science 286: 25142517, 1999.[Abstract/Free Full Text]
- Buder-Hoffmann S, Palmer C, Vacek P, Taatjes D, Mossman B. Different accumulation of activated extracellular signal-regulated kinases (ERK 1/2) and role in cell-cycle alterations by epidermal growth factor, hydrogen peroxide, or asbestos in pulmonary epithelial cells. Am J Respir Cell Mol Biol 24: 405413, 2001.[Abstract/Free Full Text]
- Cook SJ, Beltman J, Cadwallader KA, McMahon M, McCormick F. Regulation of mitogen-activated protein kinase phosphatase-1 expression by extracellular signal-related kinase-dependent and Ca2+-dependent signal pathways in Rat-1 cells. J Biol Chem 272: 1330913319, 1997.[Abstract/Free Full Text]
- Cook SJ, McCormick F. Inhibition by cAMP of Ras-dependent activation of Raf. Science 262: 10691072, 1993.[Abstract/Free Full Text]
- Cummins AB, Palmer C, Mossman BT, Taatjes DJ. Persistent localization of activated extracellular signal-regulated kinases (ERK1/2) is epithelial cell-specific in an inhalation model of asbestosis. Am J Pathol 162: 713720, 2003.[Abstract/Free Full Text]
- Frodin M, Peraldi P, Van Obberghen E. Cyclic AMP activates the mitogen-activated protein kinase cascade in PC12 cells. J Biol Chem 269: 62076214, 1994.[Abstract/Free Full Text]
- Jimenez LA, Zanella C, Fung H, Janssen YM, Vacek P, Charland C, Goldberg J, Mossman BT. Role of extracellular signal-regulated protein kinases in apoptosis by asbestos and H2O2. Am J Physiol Lung Cell Mol Physiol 273: L1029L1035, 1997.[Abstract/Free Full Text]
- Karin M. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270: 1648316486, 1995.[Free Full Text]
- Keyse SM. The role of protein phosphatases in the regulation of mitogen and stress-activated protein kinases. Free Radic Res 31: 341349, 1999.[Web of Science][Medline]
- Lonze BE, Ginty DD. Function and regulation of CREB family transcription factors in the nervous system. Neuron 35: 605623, 2002.[CrossRef][Web of Science][Medline]
- Lounsbury KM, Stern M, Taatjes D, Jaken S, Mossman BT. Increased localization and substrate activation of protein kinase C delta in lung epithelial cells following exposure to asbestos. Am J Pathol 160: 19912000, 2002.[Abstract/Free Full Text]
- Malkinson AM, Dwyer-Nield LD, Rice PL, Dinsdale D. Mouse lung epithelial cell linestools for the study of differentiation and the neoplastic phenotype. Toxicology 123: 53100, 1997.[CrossRef][Web of Science][Medline]
- Mayr B, Montminy M. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat Rev Mol Cell Biol 2: 599609, 2001.[CrossRef][Web of Science][Medline]
- Mossman BT, Bignon J, Corn M, Seaton A, Gee JB. Asbestos: scientific developments and implications for public policy. Science 247: 294301, 1990.[Abstract/Free Full Text]
- Mossman BT, Faux S, Janssen Y, Jimenez LA, Timblin C, Zanella C, Goldberg J, Walsh E, Barchowsky A, Driscoll K. Cell signaling pathways elicited by asbestos. Environ Health Perspect 105, Suppl 5: 11211125, 1997.[CrossRef][Web of Science][Medline]
- Nair BG, Patel TB. Regulation of cardiac adenylyl cyclase by epidermal growth factor (EGF). Role of EGF receptor protein tyrosine kinase activity. Biochem Pharmacol 46: 12391245, 1993.[CrossRef][Web of Science][Medline]
- Pache JC, Janssen YM, Walsh ES, Quinlan TR, Zanella CL, Low RB, Taatjes DJ, Mossman BT. Increased epidermal growth factor-receptor protein in a human mesothelial cell line in response to long asbestos fibers. Am J Pathol 152: 333340, 1998.[Abstract]
- Piiper A, Dikic I, Lutz MP, Leser J, Kronenberger B, Elez R, Cramer H, Muller-Esterl W, Zeuzem S. Cyclic AMP induces transactivation of the receptors for epidermal growth factor and nerve growth factor, thereby modulating activation of MAP kinase, Akt, and neurite outgrowth in PC12 cells. J Biol Chem 277: 4362343630, 2002.[Abstract/Free Full Text]
- Piiper A, Lutz MP, Cramer H, Elez R, Kronenberger B, Dikic I, Muller-Esterl W, Zeuzem S. Protein kinase A mediates cAMP-induced tyrosine phosphorylation of the epidermal growth factor receptor. Biochem Biophys Res Commun 301: 848854, 2003.[CrossRef][Web of Science][Medline]
- Poppleton H, Sun H, Fulgham D, Bertics P, Patel TB. Activation of Gsalpha by the epidermal growth factor receptor involves phosphorylation. J Biol Chem 271: 69476951, 1996.[Abstract/Free Full Text]
- Pulver RA, Rose-Curtis P, Roe MW, Wellman GC, Lounsbury KM. Store-operated Ca2+ entry activates the CREB transcription factor in vascular smooth muscle. Circ Res 94: 13511358, 2004.[Abstract/Free Full Text]
- Pursiheimo JP, Kieksi A, Jalkanen M, Salmivirta M. Protein kinase A balances the growth factor-induced Ras/ERK signaling. FEBS Lett 521: 157164, 2002.[CrossRef][Web of Science][Medline]
- Ramos-Nino ME, Haegens A, Shukla A, Mossman BT. Role of mitogen-activated protein kinases (MAPK) in cell injury and proliferation by environmental particulates. Mol Cell Biochem 234235: 111118, 2002.
- Riccio A, Ahn S, Davenport CM, Blendy JA, Ginty DD. Mediation by a CREB family transcription factor of NGF-dependent survival of sympathetic neurons. Science 286: 23582361, 1999.[Abstract/Free Full Text]
- Rosen LB, Ginty DD, Weber MJ, Greenberg ME. Membrane depolarization and calcium influx stimulate MEK and MAP kinase via activation of Ras. Neuron 12: 12071221, 1994.[CrossRef][Web of Science][Medline]
- Roux PP, Richards SA, Blenis J. Phosphorylation of p90 ribosomal S6 kinase (RSK) regulates extracellular signal-regulated kinase docking and RSK activity. Mol Cell Biol 23: 47964804, 2003.[Abstract/Free Full Text]
- Ryser S, Massiha A, Piuz I, Schlegel W. Stimulated initiation of mitogen-activated protein kinase phosphatase-1 (MKP-1) gene transcription involves the synergistic action of multiple cis-acting elements in the proximal promoter. Biochem J 378: 473484, 2004.[CrossRef][Web of Science][Medline]
- Scimeca JC, Servant MJ, Dyer JO, Meloche S. Essential role of calcium in the regulation of MAP kinase phosphatase-1 expression. Oncogene 15: 717725, 1997.[CrossRef][Web of Science][Medline]
- Shaywitz AJ, Greenberg ME. CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu Rev Biochem 68: 821861, 1999.[CrossRef][Web of Science][Medline]
- Shukla A, Gulumian M, Hei TK, Kamp D, Rahman Q, Mossman BT. Multiple roles of oxidants in the pathogenesis of asbestos-induced diseases. Free Radic Biol Med 34: 11171129, 2003.[CrossRef][Web of Science][Medline]
- Shukla A, Ramos-Nino M, Mossman B. Cell signaling and transcription factor activation by asbestos in lung injury and disease. Int J Biochem Cell Biol 35: 11981209, 2003.[CrossRef][Web of Science][Medline]
- Shukla A, Stern M, Lounsbury KM, Flanders T, Mossman BT. Asbestos-induced apoptosis is protein kinase C delta-dependent. Am J Respir Cell Mol Biol 29: 198205, 2003.[Abstract/Free Full Text]
- Shukla A, Timblin C, BeruBe K, Gordon T, McKinney W, Driscoll K, Vacek P, Mossman BT. Inhaled particulate matter causes expression of nuclear factor (NF)-kappaB-related genes and oxidant-dependent NF-kappaB activation in vitro. Am J Respir Cell Mol Biol 23: 182187, 2000.[Abstract/Free Full Text]
- Sommer A, Burkhardt H, Keyse SM, Luscher B. Synergistic activation of the mkp-1 gene by protein kinase A signaling and USF, but not c-Myc. FEBS Lett 474: 146150, 2000.[CrossRef][Web of Science][Medline]
- Stevenson AS, Cartin L, Wellman TL, Dick MH, Nelson MT, Lounsbury KM. Membrane depolarization mediates phosphorylation and nuclear translocation of CREB in vascular smooth muscle cells. Exp Cell Res 263: 118130, 2001.[CrossRef][Web of Science][Medline]
- Taylor SS, Kim C, Vigil D, Haste NM, Yang J, Wu J, Anand GS. Dynamics of signaling by PKA. Biochim Biophys Acta 1754: 2537, 2005.[Medline]
- Upadhyay D, Panduri V, Kamp DW. Fibroblast growth factor-10 prevents asbestos-induced alveolar epithelial cell apoptosis by a mitogen-activated protein kinase-dependent mechanism. Am J Respir Cell Mol Biol 32: 232238, 2005.[Abstract/Free Full Text]
- Yang Y, Pan X, Lei W, Wang J, Shi J, Li F, Song J. Regulation of transforming growth factor-(beta)1-induced apoptosis and epithelial-to-mesenchymal transition by protein kinase A and signal transducers and activators of transcription 3. Cancer Res 66: 86178624, 2006.[Abstract/Free Full Text]
- Yuan Z, Taatjes DJ, Mossman BT, Heintz NH. The duration of nuclear extracellular signal-regulated kinase 1 and 2 signaling during cell cycle reentry distinguishes proliferation from apoptosis in response to asbestos. Cancer Res 64: 65306536, 2004.[Abstract/Free Full Text]
- Zanella CL, Posada J, Tritton TR, Mossman BT. Asbestos causes stimulation of the extracellular signal-regulated kinase 1 mitogen-activated protein kinase cascade after phosphorylation of the epidermal growth factor receptor. Cancer Res 56: 53345338, 1996.[Abstract/Free Full Text]
- Zanella CL, Timblin CR, Cummins A, Jung M, Goldberg J, Raabe R, Tritton TR, Mossman BT. Asbestos-induced phosphorylation of epidermal growth factor receptor is linked to c-fos and apoptosis. Am J Physiol Lung Cell Mol Physiol 277: L684L693, 1999.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
A. Shukla, M. B. MacPherson, J. Hillegass, M. E. Ramos-Nino, V. Alexeeva, P. M. Vacek, J. P. Bond, H. I. Pass, C. Steele, and B. T. Mossman
Alterations in Gene Expression in Human Mesothelial Cells Correlate with Mineral Pathogenicity
Am. J. Respir. Cell Mol. Biol.,
July 1, 2009;
41(1):
114 - 123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. A. Buder-Hoffmann, A. Shukla, T. F. Barrett, M. B. MacPherson, K. M. Lounsbury, and B. T. Mossman
A Protein Kinase C{delta}-Dependent Protein Kinase D Pathway Modulates ERK1/2 and JNK1/2 Phosphorylation and Bim-Associated Apoptosis by Asbestos
Am. J. Pathol.,
February 1, 2009;
174(2):
449 - 459.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2007 by the American Physiological Society.