Am J Physiol Lung Cell Mol Physiol 292: L1396-L1404, 2007.
First published February 9, 2007; doi:10.1152/ajplung.00444.2006
1040-0605/07 $8.00
Muc5b and Muc5ac are the major oligomeric mucins in equine airway mucus
Karine Rousseau,1
Sara Kirkham,1
Shaun McKane,2
Richard Newton,3
Peter Clegg,1,2 and
David J. Thornton1
1Wellcome Trust Centre for Cell-Matrix Research, Faculty of Life Sciences, University of Manchester, Manchester, 2University of Liverpool, Faculty of Veterinary Science, Leahurst, Neston, South Wirral, and 3Animal Health Trust, Lanwades Park, Kentford, Newmarket, United Kingdom
Submitted 10 November 2006
; accepted in final form 7 February 2007
 |
ABSTRACT
|
|---|
Horses frequently suffer from respiratory diseases, which, irrespective of etiology, are often associated with airway mucus accumulation. Studies on human airways have shown that the key structural components of the mucus layer are oligomeric mucins, which can undergo changes of expression and properties in disease. However, there is little information on these gel-forming glycoproteins in horse airways mucus. Therefore, the aims of this study were to isolate equine airways oligomeric mucins, characterize their macromolecular properties, and identify their gene products. To this end, pooled tracheal washes, collected from healthy horses and horses suffering from respiratory diseases, were solubilized with 6 M guanidinium chloride (GdmCl). The oligomeric mucins were purified by density gradient centrifugation followed by size exclusion chromatography. Biochemical and biophysical analyses showed the mucins were stiffened random coils in solution that were polydisperse in size (Mr = 620 MDa, average Mr = 14 MDa) and comprised of disulfide-linked subunits (average Mr = 7 MDa). Agarose gel electrophoresis showed that the pooled mucus sample contained at least two populations of oligomeric mucins. Electrospray ionization tandem mass spectrometry of tryptic digests of the unfractionated mucin preparation showed that the oligomeric mucins Muc5b and Muc5ac were present. In summary, we have shown that equine airways mucus is a mixture of Muc5b and Muc5ac mucins that have a similar macromolecular organization to their human counterparts. This study will form the basis for future studies to analyze the contribution of these two mucins to equine airways pathology associated with mucus accumulation.
horses
THERE ARE A WIDE VARIETY OF causes of equine respiratory disease, with both infections with viruses and bacteria [inflammatory airway disease (IAD)] as well as allergic airway diseases [recurrent airway obstruction (RAO)] being common (3, 5, 32, 52). Despite differing etiologies, all forms of equine respiratory disease are associated with increased volumes of respiratory secretions and a change in the physical and chemical nature of the mucus that frequently accumulates in the trachea of affected horses (1416). Whereas the mucus gel in the respiratory tract is vital for the protection and normal function of the airways, in many circumstances, the overproduction and change in composition is a significant pathologic feature of these conditions (1416). In racehorses, respiratory diseases are the second most common reason why horses fail to train, and accumulation of tracheal mucus has been identified as a risk factor for poor racing performance in such horses (24).
The properties of mucus gels are dependent on a number of factors, but by far the most important are a family of large oligomeric, secreted glycoproteins called mucins. Studies of human airway mucus have shown that it is comprised of a mixture of oligomeric mucins (80% carbohydrate by weight) that are polydisperse in mass (240 MDa) and size (0.510 µm in length). Component mucin monomers (23 MDa) are assembled linearly and held together by disulfide bonds, and they share a generic organization (6, 34, 40, 42, 43, 49). The polypeptides have cysteine-rich motifs in their COOH and NH2 termini that are necessary for oligomerization, a central domain containing repeated serine/threonine/proline-rich regions (STP domains) to which O-glycans are attached, and interspersed among the STP domains are repeated cysteine-rich regions (cys domains) of unknown function (6, 13, 17, 34, 40, 42, 43, 49). The STP domains show little sequence homology between mucins; in contrast, the NH2- and COOH-terminal domains and the cys domains show considerable homologies (4, 12, 13, 17, 19, 50).
From studies of human airway secretions, it is clear that MUC5AC and MUC5B, and to a much lesser extent, MUC2, are key determinants of mucus gel properties (25). These glycoproteins can be changed in amount, glycoform, and size in respiratory disease, and these alterations can have dramatic clinical consequences (30, 38, 39). However, at present, little is known about the type, structure, and biochemistry of these macromolecules in equine airways mucus. A recent study (21) has shown that Muc5ac, but not Muc2, is expressed in horse airway, but to date there are no reports on the expression of equine Muc5b. In allergic airway disease in the horse (RAO), the altered physical properties of the respiratory mucus (20) have been attributed to both changes in the quality and quantity of its constituent mucins (27), suggesting that mucins are also likely to play a role in other equine respiratory disease such as IAD. Here, we have purified, characterized, and identified the oligomeric mucins from equine airways mucus. We report that Muc5b and Muc5ac are the major oligomeric mucins and that these glycoproteins have a similar macromolecular organization to their counterparts found in human airways mucus.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Mucin purification.
Endoscopic tracheal washes were obtained as part of routine diagnostic procedures in horses suffering from respiratory diseases with tracheal mucus accumulation (including diagnosed cases of IAD or RAO). Similar tracheal washes were also obtained from normal horses that had no history or clinical evidence of respiratory disease immediately following euthanasia. The protocol for mucus and tissue sample collection was approved by internal independent review within the Faculty of Veterinary Sciences, The University of Liverpool. All washes were diluted with 3 volumes of 8 M GdmCl, and all the normal (2 horses) and pathological (4 horses) tracheal washes were pooled for analysis of their mucin content. After addition of 6 M GdmCl to bring the sample to 10x the original volume, the mucins were extracted with gentle stirring at 4°C. Solubilized mucins were purified following a previously published method (47). Briefly, the extract was centrifuged in a cesium chloride (CsCl)/4 M GdmCl density gradient at a starting density of 1.4 g/ml in a Beckman Ti 45 rotor at 40,000 rpm for 65 h at 15°C. After centrifugation, the tubes were emptied from the top. Mucin-containing fractions were pooled, dialyzed against 4 M GdmCl, and further purified by gel filtration chromatography on a Sepharose CL-2B column (1.6 x 32 cm) eluted with 4 M GdmCl at a flow rate of 12 ml/h. Mucin-containing fractions were pooled and stored at 4°C.
Preparation of reduced and carboxymethylated mucins and high Mr mucin glycopeptides.
Purified mucins were dialyzed into 6 M urea or 6 M GdmCl (both containing 0.1 M Tris, 5 mM EDTA, pH 8) and reduced by treatment with 10 mM dithiothreitol (DTT) for 1 h at 37°C. Iodoacetamide was added (25 mM final concentration), and the reduced mucins were carboxymethylated for 30 min in the dark at room temperature. High Mr mucin glycopeptides were prepared by digestion of reduced mucins with trypsin (1 µg) overnight at 37°C in 0.1 M ammonium hydrogen carbonate, pH 8.0.
Rate-zonal centrifugation.
Mucins and reduced and carboxymethylated mucins were layered onto 68 M GdmCl gradients and centrifuged at 40,000 rpm in a SW 40 Ti Beckman rotor for 2.5 h at 15°C as described previously (37).
Agarose gel electrophoresis.
Reduced mucins were electrophoresed in 0.7% agarose gels at 30 V for 15 h in 40 mM Tris-acetate, 1 mM EDTA, pH 8.0, containing 0.1% (wt/vol) SDS. After electrophoresis, the proteins were vacuum-blotted onto nitrocellulose membrane for 2 h at 40 mbar in 0.6 M sodium chloride, 60 mM sodium citrate, as previously described (45).
Multiangle laser light scattering.
The molecular size distributions of intact, reduced, and carboxymethylated mucins and high Mr mucin glycopeptides were determined by multiangle laser light scattering (MALLS) essentially as described previously (35). In brief, samples were chromatographed on a TSK 6000 column (0.78 x 30 cm) eluted at a flow rate of 0.83 ml/min with 0.2 M NaCl/1 mM EDTA. The column effluent was monitored with an inline DAWN EOS laser photometer and an Optilab rEX refractometer (Wyatt Technology, Haverhill, Suffolk, United Kingdom). Light-scattering data were collected at 18 angles between 10 and 151°, and the data were analyzed according to Zimm (53).
Tryptic digestion and mass spectrometry.
Reduced and carboxymethylated mucins in 2 M urea/100 mM ammonium bicarbonate, pH 8.0, were digested overnight at 37°C with 1 µg of trypsin. Tryptic peptides were separated from high Mr glycopeptides by gel chromatography on a Sephacryl S-100 column (1 x 10 cm) eluted with 100 mM ammonium hydrogen carbonate, pH 8.0, and then lyophilized. Tryptic peptides were solubilized in 0.1% formic acid, separated by reverse-phase chromatography, and analyzed inline by positive ion electrospray ionization mass spectrometry/mass spectrometry (ESI-MS/MS) using a Quadrupole-Time of Flight (Q-ToF) Micromass spectrometer (Waters, Manchester, United Kingdom). Samples were introduced via a capillary liquid chromatography system fitted with a stream-select module (Waters). Aliquots (1050 µl) of the samples were separated on a PepMap column (0.075 x 150 mm) with a gradient of 5% acetonitrile in 0.1% formic acid to 25% acetonitrile in 0.1% formic acid over 30 min at a flow rate of 200 nl/min. Data acquired were analyzed using SWISS-PROT and TrEMBL databases using the ProteinLynx global server 1.1 software (Waters). Parameters were set to 100-mDa peptide mass tolerance, methionine oxidation and carboxyamidomethyl cysteine modification. The MS/MS spectrum of each peptide matched was examined individually with the acceptance criteria being that the parent and fragment ion masses were within the calibrated tolerance limits and that the spectrum contained a series of at least four consecutive y' ions. A custom database (see below) containing putative equine mucin sequences was also used to analyze peptide fragmentation data.
Generation of equine Muc gene genomic sequences.
Unprocessed data generated by the Horse Genome Sequencing Project is available through the National Center for Biotechnology Information (NCBI) trace archive website (http://www.ncbi.nlm.nih.gov/Traces/trace.cgi). The database consists of clones of
1,000 bp. Human MUC5AC, MUC5B, and MUC2 mRNA sequences encoding the NH2-terminal regions of the three mucins were used to perform a MegaBLAST search of the database. Clones were recovered and assembled into contigs using the program CAP3 (26). The ends of the contigs were then used to repeat the database search to extend the contig sequence. This BLAST and assembly process was repeated several times until the majority of the genomic sequence encoding the putative NH2 termini of Muc5ac and Muc5b was obtained, and a smaller fragment of the NH2 terminus of Muc2 was generated. The approach was repeated using the mRNA sequences encoding the cys domains of the human MUC5AC, MUC5B, and MUC2 genes. The intron/exon boundaries were predicted by comparison of the genomic sequences of the human and mouse mucins, since it is known that these are conserved between mucins as well as between species (12, 18, 19). The predicted exonic sequence was translated, and the resultant amino acid sequences were used to prepare a database of putative equine Muc5ac, Muc5b, and Muc2 mucin sequences.
cDNA preparation, amplification, and sequencing.
Equine tissue samples were obtained from trachea, stomach, and small intestine from a deceased foal at the Leahurst Large Animal Hospital (University of Liverpool) and collected in RNA later (Ambion, Huntingdon, United Kingdom). The mRNA was extracted using the TRIzol reagent and chloroform method (9) and then reverse-transcribed into cDNA using random primers. Oligonucleotide primers (see below) were used to amplify cDNA from equine tracheal mRNA using Abgene buffer IV [750 mM Tris·HCl (pH 8.8 at 25°C), 200 mM (NH4)2SO4, 0.1% (vol/vol) Tween 20, 15 mM MgCl2] with 0.5 µM each oligonucleotide (MWG, http://www.mwg-biotech.com/html/all/index.php), 0.2 mM each dNTP (Abgene, Epsom, United Kingdom), with 0.125 units of Taq polymerase (Abgene) per 15 µl of reaction. The amplification program consisted of 3-min denaturation at 96°C followed by 32 cycles of 30-s denaturation at 96°C, 30 s of annealing at the appropriate temperature, and 30 s of elongation at 72°C; the reactions were then completed with a 5-min elongation at 70°C. The products were visualized under a UV transilluminator after electrophoresis on 2% (wt/vol) agarose gels containing ethidium bromide. PCR products were extracted from the gel and purified using the GeneClean PCR purification kit (Qbiogene, Stretton, United Kingdom) and sequenced using the BigDye Terminator v3.1 chemistry [2.5% (vol/vol) DMSO was also added to the sequencing reaction]. Three pairs of primers were designed based on the predicted Muc5b, Muc5ac, and Muc2 sequences to examine their expression in different tissues. Fragment 1 (FR1) was amplified with 5' primer CTGCTCCAACCCTGACCACTC and 3' primer CAGCTTGTGGTGAAGGAGGC for Muc5b, FR2 using 5' primer TCAACCTGCAGTACCGCGAGTG and 3' primer AGTTGGTGCAGTCTGTGGAGTATA for Muc5ac, and FR3 using 5' primer AGCAGGACTCAGGGGTC(CT)GC and 3' primer CGTGC(CT)GGCCTCACCCTCA for Muc2.
Analytical methods.
Molecules transferred to nitrocellulose membranes by slot blotting or Western blotting were stained for total carbohydrate with periodic acid-Schiff (PAS) reagent (44) and protein with the Coomassie blue reagent. Immunodetection was performed using a polyclonal antiserum that recognizes reduced and carboxymethylated mucin subunits (34). Immuno- and Western blots were visualized using horseradish peroxidase-labeled secondary antibodies in conjunction with an ECL Western detection kit. Band intensities were measured using a Bio-Rad model GS-800-calibrated densitometer.
 |
RESULTS
|
|---|
Purification of oligomeric mucins from equine airways mucus.
Pooled tracheal washes from healthy horses, and horses suffering from respiratory disease, were solubilized in 6 M GdmCl and subjected to CsCl density gradient centrifugation (Fig. 1A). This resulted in two carbohydrate-rich peaks (monitored by PAS staining) in the high-density fractions (1.331.56 g/ml density) that were separated from the majority of the proteins (monitored by A280 measurements), which were concentrated in the lower density fractions (1.241.32 g/ml density). Agarose gel electrophoresis of fractions from across the density distribution showed bands in fractions 1020 that were reactive with an antiserum that recognizes human reduced mucin monomers (Fig. 1A, inset); these were the same fractions that contained the carbohydrate-rich material. The agarose gel analysis also showed evidence of different populations of molecules with different electrophoretic mobilities. Taken together, these data suggested that at least two populations of oligomeric mucins were present in the high-density fractions (Fig. 1A). Therefore, these fractions were pooled and dialyzed against 4 M GdmCl, and the mucins were further purified by gel filtration chromatography on a Sepharose CL-2B column (Fig. 1B). The high-molecular weight mucins (PAS staining material in fractions 1325) were separated from lower Mr glycoproteins (PAS staining material in fractions 2640) and the remaining smaller proteins (Coomassie blue staining material in fractions 30-52). Mucin-containing fractions (fractions 1325) were pooled (Fig. 1B) and used for further characterization.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1. Purification of equine respiratory mucins. A: equine respiratory mucus was extracted with 6 M guanidinium chloride (GdmCl), and the extract was subjected to cesium chloride/4 M GdmCl density gradient centrifugation. Fractions were analyzed for carbohydrate [periodic acid-Schiff (PAS) assay; open circles], proteins (A280; closed circles), and density (open triangles). Also, aliquots from each fraction were reduced, carboxymethylated, subjected to 0.7% (wt/vol) agarose gel electrophoresis, and subsequently Western blotted onto nitrocellulose. The blot (inset) was analyzed for reactivity with a polyclonal antiserum that recognizes reduced and carboxymethylated mucin subunits (34). Fractions 1019 were pooled and dialyzed against 4 M GdmCl, and the mucins were further purified by gel filtration chromatography (B) on Sepharose CL-2B eluted with 4 M GdmCl. The column eluent was analyzed for carbohydrate (PAS assay; open circles) and proteins (Coomassie blue stain; closed circles), and fractions 1325 were pooled for further study.
|
|
Mucin characterization.
The molecular size distribution of the mucins was monitored by rate-zonal centrifugation on 68 M GdmCl gradients (Fig. 2). The intact molecules exhibited a broad range of sedimentation rates consistent with a polydisperse population of high-molecular weight mucins (Fig. 2). However, treatment with the reducing agent DTT caused a marked decrease in sedimentation rate and polydispersity (Fig. 2) and suggested the mucins were oligomeric assemblies stabilized by disulfide bonds. To gain more insight into the size and molecular architecture of the mucins, MALLS was performed on the intact mucins and the major fragments produced after reduction (reduced monomers) and reduction followed by trypsin digestion (high Mr glycopeptides). Each of the three samples was subjected to gel filtration chromatography on a TSK 6000 column (Fig. 3), and the absolute size (radius of gyration, RG) and Mr distributions were determined across the chromatograms (Table 1). The data showed that the mucin oligomers were polydisperse in both size and Mr, and, as expected from the rate-zonal centrifugation analysis, reduction of disulfide bonds caused a decrease in Mr, size, and polydispersity of the mucins (Table 1). Trypsin digestion of the reduced mucins caused a further reduction in Mr and size of the majority of the preparation (Table 1). These fragmentation patterns are consistent with the behavior of oligomeric mucins isolated from human airways mucus (3840, 48, 49). It should be noted that a minor component was also produced after trypsin digestion of the reduced mucins with average Mr of 6.2 MDa and RG of 220 nm. This might represent undigested oligomeric mucins or another trypsin-resistant glycoprotein present in the preparation.

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 2. Rate-zonal centrifugation of purified equine respiratory mucins. The purified mucins, before (closed circles) and after reduction (open circles), were centrifuged on a 68 M GdmCl gradient, and fractions were analyzed for carbohydrate using a PAS assay (37). Fractions 1 (6 M GdmCl) and 23 (8 M GdmCl) are the top and the bottom of the gradient, respectively.
|
|

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 3. Determination of molecular size distributions of equine respiratory mucins before and after fragmentation. The intact mucins (solid line), the reduced and carboxymethylated mucins (dotted line), and the reduced, carboxymethylated, and trypsin-treated mucins (dashed line) were chromatographed on a TSK 6000 column, and the effluent was monitored for light scattering and refractive index (see EXPERIMENTAL PROCEDURES). The calculated values for Mr and radius of gyration (RG) across the distributions and the average values for Mr and RG are presented in Table 1.
|
|
The relationship between molecular shape (RG) and Mr of molecules in solution can be expressed by the value of the Mark-Houwink parameter (
), which can be obtained from the equation RG = A Mr
(A is a constant related to the mass per unit length of the molecule). A plot of log RG against log Mr across the chromatographic distribution of the intact oligomers is shown in Fig. 4. The slope of the line yielded a value of
= 0.64, which suggests that the mucins have a stiffened random coil conformation in solution.

View larger version (5K):
[in this window]
[in a new window]
|
Fig. 4. Relationship between the size and shape of the oligomeric mucins. The unreduced mucins were chromatographed on TSK 6000, and the column effluent was monitored for light scattering and refractive index as described in EXPERIMENTAL PROCEDURES. The data used in this analysis are for the molecules eluting between 5.5 and 7.5 ml (see Fig. 3). The slope ( ) of the log-log plot of the dependence of Mr and RG yields a value of 0.64.
|
|
Mucin identification.
The mucin preparation was subjected to reduction and carboxymethylation followed by digestion with trypsin to generate peptides for subsequent analysis by ESI-MS/MS. The peptide fragmentation data produced were searched against the SWISS-PROT and TrEMBL databases to identify matches with known mucin sequences. No equine mucin sequences were identified that matched the peptide fragmentation data. However, four peptide matches with sequences from human MUC5B (Fig. 5A), one peptide from mouse Muc5b (Fig. 5B), two peptide matches from mouse Muc5ac (Fig. 5C), and one peptide that matched a sequence present in both mouse Muc5ac and Muc5b were identified (Fig. 5D). No perfect matches were found to human MUC2 or mouse Muc2. These data suggest that homologs of the two major human oligomeric mucins, MUC5AC and MUC5B, are present in equine airways mucus.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 5. Mucin identification by electrospray ionization mass spectrometry/mass spectrometry (ESI-MS/MS). The sample analyzed was a tryptic digest of the mucin preparation after reduction and carboxymethylation. Exact peptide matches were found to human MUC5B (A), mouse MUC5B (B and D), and mouse Muc5ac (C and D). Comparison to sequences in human MUC5B (Q9HC84), MUC5AC (Q8WWQ5 and P98088), and MUC2 (Q02817) and mouse Muc5b (Q8K1G6), Muc5ac (Q80Z21 and Q80Z20), and Muc2 (Q80Z19 and Q80Z17) are shown. The numbers show the start position of the residues within the polypeptide sequence, and highlighted in black boxes are differences with the matched peptides. The asterisks indicate peptides that are repeated several times in the protein.
|
|
Predicted sequences of equine Muc5ac, Muc5b, and Muc2.
The lack of peptide matches to equine mucins is most likely because of the scarcity of equine mucin sequences in the SWISS-PROT and TrEMBL databases. Therefore, to gain a more comprehensive analysis of the peptide fragmentation data, we assembled sequences corresponding to these three genes from unprocessed clones from the Horse Genome Sequencing Project (http://www.ncbi.nlm.nih.gov/Traces/trace.cgi). To achieve this, we performed a BLAST search of the database using mRNA sequences encoding the NH2-terminal region of human MUC5B, MUC5AC, and MUC2. One hundred forty-six clones were isolated and assembled to generate nine different contigs. On the basis of their similarity to the human mucins at the level of both nucleotide and the translated amino acid sequences, four contigs (assembled from 70 clones) were assigned to Muc5b, three contigs (assembled from 69 clones) to Muc5ac, and two contigs (assembled from 7 clones) to Muc2. The translation and alignment of these sequences with human MUC5B (Fig. 6A), MUC5AC (Fig. 6B), and MUC2 (Fig. 6C) showed the equine Muc5b, Muc5ac, and Muc2 sequences to have 80.93%, 78.95%, and 82.85% identity to human MUC5B, MUC5AC, and MUC2, respectively. In addition, the database was also searched with sequences encoding the cys domains of the three human genes to identify similar cysteine rich domains of the putative equine Muc5b, Muc5ac, and Muc2 genes. Using human MUC5B cys domain sequences, four clones were isolated that were assembled into two contigs, which, after translation, resulted in a polypeptide sequence similar to MUC5B cys domains (Fig. 7A). Using human MUC5AC sequence, 33 clones were isolated and assembled into a contig that, after translation, resulted in a polypeptide sequence containing four regions that were similar to MUC5AC cys domains. (Fig. 7B). Using the human Muc2 cys domain sequences, 10 clones were isolated, which were assembled into two contigs that, after translation, resulted in a polypeptide sequence similar to MUC2 cys domains (Fig. 7C).

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 6. Alignment of human MUC5B (Q9HC84), MUC5AC (Q8WWQ5), and MUC2 (Q02817) NH2-terminal polypeptide sequences with the predicted equine Muc5b, Muc5ac, and Muc2 sequences. Human MUC5B sequence Q9HC84 (from amino acid 68), MUC5AC sequence Q8WWQ5 (from amino acid 72), and MUC2 Q02817 (from amino acid 117) were used for this alignment (A, B, and C, respectively). The asterisks indicate differences between the human and predicted equine (eqMuc) sequences, and the gaps necessary for the alignment are shown with dashes. The gaps between the assembled contigs are shown with dots. The peptide matches found by ESI-MS/MS analysis are highlighted in the black boxes.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7. Alignment of human MUC5B (Q9HC84), MUC5AC (Q8WWQ5), and MUC2 (Q02817) cys domain polypeptide sequences with the predicted equine Muc5b (A), Muc5ac (B), and Muc2 (C) sequences. The asterisks indicate differences between the human and predicted equine (eqMuc) sequences. The peptide matches found by ESI-MS/MS analysis are highlighted in the black boxes. Human MUC5AC cys domains 2 and 4, and 3 and 5 differ by a few amino acids; however, only 1 sequence is shown, and the alternative amino acids are indicated on the line above the sequences.
|
|
Reanalysis of the ESI-MS/MS peptide fragmentation data.
The novel Muc5b-, Muc5ac-, and Muc2-predicted amino acid sequences were added to a custom protein database that was used to reanalyze the ESI-MS/MS data. This allowed for identification of 33 peptides from the predicted Muc5b and five peptides from Muc5ac (Figs. 6 and 7). For Muc5b, 17 peptides were in the NH2-terminal region (Fig. 6A), and 16 were from the putative cys domains (Fig. 7A). For Muc5ac, only peptides corresponding to the cys domains were found (Fig. 7B). This suggests that both of these glycoproteins are present in the preparation. No peptide matches were found for the predicted Muc2 sequences.
Tissue expression.
To confirm the assignment of the three putative equine mucins, we examined their tissue expression. Three pairs of oligonucleotides were designed to amplify fragments that were predicted to encode corresponding regions in the NH2-terminal region of equine Muc5ac, Muc5b, and Muc2. These oligonucleotides were used to amplify cDNA extracted from trachea, stomach, and small intestine. The putative Muc5b fragment was expressed only in trachea, whereas putative Muc5ac was expressed in trachea as well as stomach, and the Muc2 fragment was only expressed in the small intestine (Fig. 8). Primer pairs FR1 (Muc5b) and FR2 (Muc5ac) were also amplified from equine genomic DNA, and all four amplified products (2 from cDNA and 2 from genomic DNA) were of the expected size, and their sequences were identical to the predicted sequences (data not shown). Furthermore, the sequence of the PCR fragment amplified with the primer pair FR3 (Muc2) was identical to the predicted sequence. These results indicate that the assembly and assignment was correct for these three mucin fragments.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 8. Tissue expression of equine Muc5ac, Muc5b, and Muc2. Oligonucleotide primers, designed based on the predicted sequences, amplified products of the expected size (179 bp for Muc5b, 230 bp for Muc5ac, and 239 bp for Muc2) and sequence. The amplified products of Muc5b, Muc5ac, and Muc2 genes from trachea (lane 1), stomach (lane 2), and small intestine (lane 3) are shown.
|
|
 |
DISCUSSION
|
|---|
Using a two-step purification scheme (density gradient centrifugation followed by gel filtration), we have successfully isolated a heterogeneous population of oligomeric mucins from equine airways mucus. Density gradient centrifugation and agarose gel electrophoresis indicated that at least two populations of oligomeric mucins were present in the preparation. Rate-zonal centrifugation and MALLS analyses of the purified mucins, before and after reduction, indicated that the equine mucins are polydisperse oligomers (average Mr = 14 MDa) comprised of monomeric units (average Mr = 7 MDa) held together by disulfide bridges. Trypsin digestion of the reduced monomers gave rise to high Mr glycopeptides (average Mr = 2.6 MDa) that correspond to the glycosylated regions of the molecule. These data suggest that the mucin monomers contain glycosylated proteinase-resistant domains flanked by cysteine-containing regions of the protein core less substituted with glycan chains. This organization is consistent with the identification of peptides in the ESI-MS/MS analysis that likely arise from cys domains that, in human mucins, are situated between the STP domains (13, 17, 46). Taken together, these data demonstrate that horse airways oligomeric mucins are very similar in molecular architecture to their human counterparts. Interestingly, the reduced monomers and the high Mr glycopeptides from the horse mucins appear on average two to three times larger than those from human mucins (35, 46, 47). We cannot rule out that these differences in size are due to association between molecules in the nonchaotropic solvent (0.2 M NaCl) employed for the column chromatography; however, a similar solvent was also employed for studies on human mucins (35, 46, 47). Analysis of the relationship between size and shape of the mucins provides further details on their macromolecular architecture. The value for the shape-dependent Mark-Houwink parameter (
= 0.64) suggests that the mucins adopt a stiffened random coil conformation in solution. This value is higher than that determined for other mixtures of oligomeric mucins (10, 36, 40) but very similar to that determined for MUC5AC mucins (
= 0.69) produced by cultured HT29 human intestinal cells in culture (35). Overall, the data presented are consistent with the equine oligomeric mucins being linear, flexible macromolecules in solution.
ESI-MS/MS fragmentation analysis of tryptic peptides derived from the purified mucin preparation identified a small number of peptides that matched with sequences from human (and mouse) oligomeric mucins MUC5AC and MUC5B. This suggested that equine airways mucus contained homologs of these two major human airways mucins. No equine mucin sequences were found by this analysis, and this can be explained because of the lack of published equine mucin sequences in the databases used for the analysis of the peptide fragmentation data (SWISS-PROT and TrEMBL). To gain more certainty in the identification of these two mucins, we derived predicted amino acid sequences for putative equine Muc5ac and Muc5b using unprocessed genomic sequence data (http://www.ncbi.nlm.nih.gov/Traces/trace.cgi). Reanalyzing the MS/MS data against these novel equine sequences identified peptides derived from Muc5b (33 peptides) and Muc5ac (5 peptides). Muc5b peptides were from both the NH2-terminal (17 peptides) and the cys domains (16 peptides), whereas the five peptides that matched putative Muc5ac were only from the cys domains. Taken together, the ESI-MS/MS data suggest that Muc5b and Muc5ac are major oligomeric mucins in equine airways mucus, and furthermore, we conclude that Muc5b is more abundant than Muc5ac. We draw this conclusion for two reasons. First, based on the fact that more peptides were matched with sequences from the putative Muc5b, and second, three of the five peptides from Muc5ac are from repeated cys domain sequences, which should be at higher relative abundance compared with the unique sequence in the NH2 terminus (46) where none were found.
The identification of Muc5ac and Muc5b in equine airways mucus is in good agreement with studies on human airways mucus that have demonstrated that MUC5AC and MUC5B are the major oligomeric mucins (46) and preliminary data that showed cross-reactivity of glycoproteins from equine airways mucus with anti-human MUC5AC and MUC5B polyclonal antisera (51). However, whereas Muc5ac expression has been demonstrated previously in equine airways tissue (21), this is the first study to validate the presence of this mucin in equine respiratory mucus. Moreover, this is the first study to demonstrate the expression of Muc5b in equine airways tissue and to isolate and characterize the glycoprotein product. The horse is the third species (in addition to human and mouse) in which both Muc5b and Muc5ac have been identified in the airways (8, 18, 29, 41, 46, 54). This provides evidence that the production of these mucins is important for the protective function of the mucus gel in the airways; however, the role of each individual mucin is still unknown.
Our data on mRNA expression and protein identification indicate that Muc2 is not likely to be major component of equine airways mucus. This is in agreement with Gerber and colleagues (21), who have shown that Muc2 is not expressed in the airways of horses suffering from RAO. It is important to note that our data does not rule out the presence of other oligomeric mucins in the secretion.
Because of the small number of published equine mucin sequences, it was necessary to assemble putative Muc5ac and Muc5b equine mucin sequences using the unprocessed data available from the Horse Genome Sequencing Project to effectively analyze the ESI-MS/MS data. The assumption on which we based our approach was that equine mucin genes have a similar structure to their human homologs, in particular that their central regions do not contain introns and consist of STP-rich regions interspersed with cys domains. This is a reasonable assumption considering that the mucin genes from other species have been found to have the same organization as the human (12, 17, 19, 50), and furthermore, the biochemical and biophysical characterization data presented here showed the mucins to have the same molecular architecture as the human counterparts. The successful identification of peptides using this data verifies that our approach was valid but it is possible that we might have assembled hybrid sequences. However, amplification and sequencing of cDNA fragments from the corresponding region of each putative gene showed that the predicted sequences were correct. Moreover, the two putative mucins showed differential tissue expression: the fragment from Muc5b was expressed in trachea, whereas Muc5ac was expressed in trachea and stomach, and Muc2 in small intestine. This is in agreement with expression pattern of these mucins in human tissues (1, 22, 23, 32, 42, 47). Thus both the sequencing data and tissue expression data indicate that the assembly and assignment was at least correct for these two fragments.
The respiratory syndromes commonly referred to as IAD (5, 48) and RAO (formerly known as chronic obstructive pulmonary disease or COPD; Refs. 19, 25, 29) are both characterized by excess airway mucus and associated neutrophilic inflammation. Therefore, despite probably different underlying etiologies (infectious for IAD and environmental for RAO) and opposing trends in population prevalence with age (decreasing for IAD and increasing for RAO), it remains difficult to readily clinically distinguish these conditions in individual animals. Therefore, the ability to demonstrate detectable differences in the mucins involved in IAD and RAO will theoretically permit development of differential diagnostic tests for these important and prevalent equine respiratory syndromes, thereby informing the most appropriate management of cases.
In summary, we have shown that airways equine mucus is a mixture of two oligomeric mucins, Muc5b and Muc5ac, with Muc5b being more abundant. These findings represent the groundwork for future studies on the role of these gel-forming glycoproteins in equine airways mucus in health and disease.
 |
GRANTS
|
|---|
This work was funded by the Horserace Betting Levy Board.
 |
ACKNOWLEDGMENTS
|
|---|
We acknowledge Drs. David Knight and Thomas A. Jowitt for advice with mass spectrometry and light-scattering analyses, respectively. We also thank Marj Howard and Emma Keevill for technical assistance.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: D. J. Thornton, Wellcome Trust Centre for Cell-Matrix Research, Faculty of Life Sciences, The Michael Smith Bldg., Univ. of Manchester, Manchester, United Kingdom M13 9PT (e-mail: dave.thornton{at}manchester.ac.uk)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Audie JP, Janin A, Porchet N, Copin MC, Gosselin B, Aubert JP. Expression of human mucin genes in respiratory, digestive, and reproductive tracts ascertained by in situ hybridization. J Histochem Cytochem 41: 14791485, 1993.[Abstract]
- Bailey CJ, Reid SW, Hodgson DR, Rose RJ. Impact of injuries and disease on a cohort of two- and three-year-old thoroughbreds in training. Vet Rec 145: 487493, 1999.[Abstract/Free Full Text]
- Bartner LR, Robinson NE, Kiupel M, Tesfaigzi Y. Persistent mucus accumulationA consequence of delayed bronchial mucous cell apoptosis in RAO-affected horses? Am J Physiol Lung Cell Mol Physiol 291: L602L609, 2006.[Abstract/Free Full Text]
- Buisine MP, Desseyn JL, Porchet N, Degand P, Laine A, Aubert JP. Genomic organization of the 3'-region of the human MUC5AC mucin gene: additional evidence for a common ancestral gene for the 11p15.5 mucin gene family. Biochem J 332: 729738, 1998.[Web of Science][Medline]
- Burrell MH, Wood JL, Whitwell KE, Chanter N, Mackintosh ME, Mumford JA. Respiratory disease in thoroughbred horses in training: the relationships between disease and viruses, bacteria and environment. Vet Rec 139: 308313, 1996.[Abstract/Free Full Text]
- Carlstedt I, Sheehan JK. Structure and macromolecular properties of cervical mucus glycoproteins. Symp Soc Exp Biol 43: 289316, 1989.[Medline]
- Chen Y, Zhao YH, Kalaslavadi TB, Hamati E, Nehrke K, Le AD, Ann DK, Wu R. Genome-wide search and identification of a novel gel-forming mucin MUC19/Muc19 in glandular tissues. Am J Respir Cell Mol Biol 30: 155165, 2003.[Web of Science]
- Chen Y, Zhao YH, Wu R. In silico cloning of mouse Muc5b gene and upregulation of its expression in mouse asthma model. Am J Respir Crit Care Med 164: 10591066, 2001.[Abstract/Free Full Text]
- Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156159, 1987.[Web of Science][Medline]
- Davies JR, Hovenberg HW, Linden CJ, Howard R, Richardson PS, Sheehan JK, Carlstedt I. Mucins in airway secretions from healthy and chronic bronchitic subjects. Biochem J 313: 431439, 1996.[Web of Science][Medline]
- Davies JR, Svitacheva N, Lannefors L, Kornfalt R, Carlstedt I. Identification of MUC5B, MUC5AC and small amounts of MUC2 mucins in cystic fibrosis airway secretions. Biochem J 344: 321330, 1999.[CrossRef][Web of Science][Medline]
- Desseyn JL, Buisine MP, Porchet N, Aubert JP, Degand P, Laine A. Evolutionary history of the 11p15 human mucin gene family. J Mol Evol 46: 102106, 1998.[CrossRef][Web of Science][Medline]
- Desseyn JL, Guyonnet-Duperat V, Porchet N, Aubert JP, Laine A. Human mucin gene MUC5B, the 10.7-kb large central exon encodes various alternate subdomains resulting in a super-repeat. Structural evidence for a 11p155 gene family. J Biol Chem 272: 31683178, 1997.[Abstract/Free Full Text]
- Dixon PM. Respiratory mucociliary clearance in the horse in health and disease, and its pharmaceutical modification. Vet Rec 131: 229235, 1992.[Abstract]
- Dixon PM, Pirie RS. Excessive airway mucus in horses with pulmonary disease: is it caused by mucus overproduction, decreased clearance or both? Equine Vet J 35: 222223, 2003.[CrossRef][Web of Science][Medline]
- Dixon PM, Railton DI, McGorum BC. Equine pulmonary disease: a case control study of 300 referred cases. Part 3: ancillary diagnostic findings. Equine Vet J 27: 428435, 1995.[Web of Science][Medline]
- Escande F, Aubert JP, Porchet N, Buisine MP. Human mucin gene MUC5AC: organization of its 5'-region and central repetitive region. Biochem J 358: 763772, 2001.[CrossRef][Web of Science][Medline]
- Escande F, Porchet N, Aubert JP, Buisine MP. The mouse Muc5b mucin gene: cDNA and genomic structures, chromosomal localization and expression. Biochem J 363: 589598, 2002.[CrossRef][Web of Science][Medline]
- Escande F, Porchet N, Bernigaud A, Petitprez D, Aubert JP, Buisine MP. The mouse secreted gel-forming mucin gene cluster. Biochim Biophys Acta 1676: 240250, 2004.[Medline]
- Gerber V, King M, Schneider DA, Robinson NE. Tracheobronchial mucus viscoelasticity during environmental challenge in horses with recurrent airway obstruction. Equine Vet J 32: 411417, 2000.[Web of Science][Medline]
- Gerber V, Robinson NE, Venta RJ, Rawson J, Jefcoat AM, Hotchkiss JA. Mucin genes in horse airways: MUC5AC, but not MUC2, may play a role in recurrent airway obstruction. Equine Vet J 35: 252257, 2003.[Web of Science][Medline]
- Gum JR, Byrd JC, Hicks JW, Toribara NW, Lamport DT, Kim YS. Molecular cloning of human intestinal mucin cDNAs. Sequence analysis and evidence for genetic polymorphism. J Biol Chem 264: 64806487, 1989.[Abstract/Free Full Text]
- Guyonnet Duperat V, Audie JP, Debailleul V, Laine A, Buisine MP, Galiegue-Zouitina S, Pigny P, Degand P, Aubert JP, Porchet N. Characterization of the human mucin gene MUC5AC: a consensus cysteine-rich domain for 11p15 mucin genes? Biochem J 305: 211219, 1995.[Web of Science][Medline]
- Holcombe SJ, Robinson NE, Derksen FJ, Bertold B, Genovese R, Miller R, de Feiter RH, Carr EA, Eberhart SW, Boruta D, Kaneene JB. Effect of tracheal mucus and tracheal cytology on racing performance in Thoroughbred racehorses. Equine Vet J 38: 300304, 2006.[CrossRef][Web of Science][Medline]
- Hovenberg HW, Davies JR, Herrmann A, Linden CJ, Carlstedt I. MUC5AC, but not MUC2, is a prominent mucin in respiratory secretions. Glycoconj J 13: 839847, 1996.[CrossRef][Web of Science][Medline]
- Huang X, Madan A. CAP3: a DNA sequence assembly program. Genome Res 9: 868877, 1999.[Abstract/Free Full Text]
- Jefcoat AM, Hotchkiss JA, Gerber V, Harkema JR, Basbaum CB, Robinson NE. Persistent mucin glycoprotein alterations in equine recurrent airway obstruction. Am J Physiol Lung Cell Mol Physiol 281: L704L712, 2001.[Abstract/Free Full Text]
- Jeffcott LB, Rossdale PD, Freestone J, Frank CJ, Towers-Clark PF. An assessment of wastage in thoroughbred racing from conception to 4 years of age. Equine Vet J 14: 185198, 1982.[Web of Science][Medline]
- Kaneko Y, Yanagihara K, Seki M, Kuroki M, Miyazaki Y, Hirakata Y, Mukae H, Tomono K, Kadota J, Kohno S. Clarithromycin inhibits overproduction of muc5ac core protein in murine model of diffuse panbronchiolitis. Am J Physiol Lung Cell Mol Physiol 285: L847L853, 2003.[Abstract/Free Full Text]
- Kirkham S, Sheehan JK, Knight D, Richardson PS, Thornton DJ. Heterogeneity of airways mucus: variations in the amounts and glycoforms of the major oligomeric mucins MUC5AC and MUC5B. Biochem J 361: 537546, 2002.[CrossRef][Web of Science][Medline]
- Nordman H, Davies JR, Lindell G, de Bolos C, Real F, Carlstedt I. Gastric MUC5AC and MUC6 are large oligomeric mucins that differ in size, glycosylation and tissue distribution. Biochem J 364: 191200, 2002.[Web of Science][Medline]
- Robinson NE, Derksen FJ, Olszewski MA, Buechner-Maxwell VA. The pathogenesis of chronic obstructive pulmonary disease of horses. Br Vet J 152: 283306, 1996.[Web of Science][Medline]
- Rossdale PD, Hopes R, Digby NJ, Offord K. Epidemiological study of wastage among racehorses 1982 and 1983. Vet Rec 116: 6669, 1985.[Abstract]
- Sheehan JK, Boot-Handford RP, Chantler E, Carlstedt I, Thornton DJ. Evidence for shared epitopes within the naked' protein domains of human mucus glycoproteins. A study performed by using polyclonal antibodies and electron microscopy. Biochem J 274: 293296, 1991.[Web of Science][Medline]
- Sheehan JK, Brazeau C, Kutay S, Pigeon H, Kirkham S, Howard M, Thornton DJ. Physical characterization of the MUC5AC mucin: a highly oligomeric glycoprotein whether isolated from cell culture or in vivo from respiratory mucous secretions. Biochem J 347: 3744, 2000.[CrossRef][Web of Science][Medline]
- Sheehan JK, Carlstedt I. Hydrodynamic properties of human cervical-mucus glycoproteins in 6M-guanidinium chloride. Biochem J 217: 93101, 1984.[Web of Science][Medline]
- Sheehan JK, Carlstedt I. Size heterogeneity of human cervical mucus glycoproteins. Studies performed with rate-zonal centrifugation and laser light-scattering. Biochem J 245: 757762, 1987.[Web of Science][Medline]
- Sheehan JK, Howard M, Richardson PS, Longwill T, Thornton DJ. Physical characterization of a low-charge glycoform of the MUC5B mucin comprising the gel-phase of an asthmatic respiratory mucous plug. Biochem J 338: 507513, 1999.[CrossRef][Web of Science][Medline]
- Sheehan JK, Richardson PS, Fung DC, Howard M, Thornton DJ. Analysis of respiratory mucus glycoproteins in asthma: a detailed study from a patient who died in status asthmaticus. Am J Respir Cell Mol Biol 13: 748756, 1995.[Abstract]
- Sheehan JK, Thornton DJ, Somerville M, Carlstedt I. Mucin structure. The structure and heterogeneity of respiratory mucus glycoproteins. Am Rev Respir Dis 144: S4S9, 1991.[Web of Science][Medline]
- Thornton DJ, Carlstedt I, Howard M, Devine PL, Price MR, Sheehan JK. Respiratory mucins: identification of core proteins and glycoforms. Biochem J 316: 967975, 1996.[Web of Science][Medline]
- Thornton DJ, Davies J, Carlstedt I, Sheehan JK. Structure and biochemistry of respiratory mucins. In Airway Mucus: Basic Mechanisms and Clinical Perspectives, edited by Rogers DF and Lethem MI. Basel: Birkhäuser, 1997, p. 1939.
- Thornton DJ, Davies JR, Kraayenbrink M, Richardson PS, Sheehan JK, Carlstedt I. Mucus glycoproteins from normal human tracheobronchial secretion. Biochem J 265: 179186, 1990.[Web of Science][Medline]
- Thornton DJ, Holmes DF, Sheehan JK, Carlstedt I. Quantitation of mucus glycoproteins blotted onto nitrocellulose membranes. Anal Biochem 182: 160164, 1989.[CrossRef][Web of Science][Medline]
- Thornton DJ, Howard M, Devine PL, Sheehan JK. Methods for separation and deglycosylation of mucin subunits. Anal Biochem 227: 162167, 1995.[CrossRef][Web of Science][Medline]
- Thornton DJ, Howard M, Khan N, Sheehan JK. Identification of two glycoforms of the MUC5B mucin in human respiratory mucus. Evidence for a cysteine-rich sequence repeated within the molecule. J Biol Chem 272: 95619566, 1997.[Abstract/Free Full Text]
- Thornton DJ, Khan N, Mehrotra R, Howard M, Veerman E, Packer NH, Sheehan JK. Salivary mucin MG1 is comprised almost entirely of different glycosylated forms of the MUC5B gene product. Glycobiology 9: 293302, 1999.[Abstract/Free Full Text]
- Thornton DJ, Sheehan JK, Carlstedt I. Heterogeneity of mucus glycoproteins from cystic fibrotic sputum. Are there different families of mucins? Biochem J 276: 677682, 1991.[Web of Science][Medline]
- Thornton DJ, Sheehan JK, Lindgren H, Carlstedt I. Mucus glycoproteins from cystic fibrotic sputum. Macromolecular properties and structural architecture. Biochem J 276: 667675, 1991.[Web of Science][Medline]
- Toribara NW, Gum JR Jr, Culhane PJ, Lagace RE, Hicks JW, Petersen GM, Kim YS. MUC-2 human small intestinal mucin gene structure. Repeated arrays and polymorphism. J Clin Invest 88: 10051013, 1991.[Web of Science][Medline]
- Walley EA, Thornton DJ, Corfield AP, Carrington SD, Sheehan JK. Characterisation of equine respiratory tract mucins. In: World Equine Airway Symposium, Edinburgh, 2001.
- Wood JL, Newton JR, Chanter N, Mumford JA. Inflammatory airway disease, nasal discharge and respiratory infections in young British racehorses. Equine Vet J 37: 236242, 2005.[CrossRef][Web of Science][Medline]
- Zimm BH. The scattering of light and the radial distribution function of high polymer solutions. J Chem Phys 10091116, 1948.
- Zuhdi AM, Piazza FM, Selby DM, Letwin N, Huang L, Rose MC. Muc-5/5ac mucin messenger RNA and protein expression is a marker of goblet cell metaplasia in murine airways. Am J Respir Cell Mol Biol 22: 253260, 2000.[Abstract/Free Full Text]
Copyright © 2007 by the American Physiological Society.