Am J Physiol Lung Cell Mol Physiol 293: L199-L211, 2007.
First published May 18, 2007; doi:10.1152/ajplung.00020.2007
1040-0605/07 $8.00
Paxillin-
-catenin interactions are involved in Rac/Cdc42-mediated endothelial barrier-protective response to oxidized phospholipids
Anna A. Birukova,
Irina Malyukova,
Valery Poroyko, and
Konstantin G. Birukov
Department of Medicine, University of Chicago, Chicago, Illinois
Submitted 17 January 2007
; accepted in final form 2 May 2007
 |
ABSTRACT
|
|---|
Oxidized phospholipids may appear in the pulmonary circulation as a result of acute lung injury or inflammation. We have previously described barrier-protective effects of oxidized 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (OxPAPC) on human pulmonary endothelial cells (EC) mediated by small GTPases Rac and Cdc42. This work examined OxPAPC-induced focal adhesion (FA) and adherens junction (AJ) remodeling and potential interactions between FA and AJ protein complexes involved in OxPAPC-induced EC barrier enhancement. Immunofluorescence analysis, subcellular fractionation, and coimmunoprecipitation assays have shown that OxPAPC induced translocation and peripheral accumulation of FA complexes containing paxillin, focal adhesion kinase, vinculin, GIT1, and GIT2, increased association of AJ proteins vascular endothelial-cadherin, p120-catenin,
-,
-, and
-catenins, and dramatically enhanced cell junction areas covered by AJ. Coimmunoprecipitation, pulldown assays, and confocal microscopy studies have demonstrated that OxPAPC promoted novel interactions between FA and AJ complexes via paxillin and
-catenin association, which was critically dependent on Rac and Cdc42 activities and was abolished by pharmacological or small interfering RNA (siRNA)-mediated inhibition of Rac and Cdc42. Depletion of
-catenin using the siRNA approach attenuated OxPAPC-induced paxillin translocation to the cell periphery, but also significantly decreased interaction of paxillin with AJ protein complex. In turn, paxillin knockdown by specific siRNA attenuated AJ enhancement in response to OxPAPC. These results show for the first time the novel interactions between FA and AJ protein complexes critical for EC barrier regulation by OxPAPC.
small GTPases; cytoskeleton; pulmonary endothelium; permeability
RESTORATION OF ENDOTHELIAL barrier function is critical for resolution of highly morbid conditions such as ventilator-induced lung injury, pulmonary edema, or increased vascular permeability in systemic circulation associated with trauma, sepsis, or inflammation.
Although importance of endothelial cytoskeleton in dynamic regulation of endothelial cell (EC) permeability is well recognized (22, 34), the role of EC adhesive complexes in the EC barrier responses is less understood. Substrate attachment and integration of pulmonary EC into monolayer is critically dependent on proper organization of cellular adhesive complexes. Increasing evidence suggests that barrier-protective chemical and mechanical stimuli such as sphingosine-1-phosphate, hepatocyte growth factor, and laminar shear stress induce peripheral redistribution of focal adhesions (FA) and enhancement of adherens junctions (AJ) associated with Rac activation (3, 29, 31, 45, 46, 50, 51); however, interactions between cell-cell and cell-substrate adhesive complexes in EC barrier-protective reactions remain unexplored.
FA form a critical bidirectional linkage between the actin cytoskeleton and the cell-extracellular matrix interface (19) thus providing additional tethering forces that help maintain EC barrier integrity. Regulation of FA dynamics is a complex process (42) mediated by several GTPases, that, however, converge on few key regulatory FA proteins, such as scaffold/signaling proteins paxillin, FA kinase (FAK), and
PIX, and Rac/Cdc42 effectors, PAK, G protein-coupled receptor kinase interacting protein 1 (GIT1), and paxillin kinase linker (PKL/GIT2) (16, 49, 56, 61). Paxillin is a multidomain adapter FA protein that functions as a molecular scaffold for protein recruitment to FA and thereby facilitates protein networking and efficient signal transmission (48, 49). Through the multiple SH2- and SH3-binding domains, LIM, and LD motifs, paxillin interacts with signaling proteins Crk, p60Src-kinase, Csk, FAK, Pyk2, ILK, and structural FA-associated proteins vinculin, actopaxin, and tubulin (48).
Members of ADP-ribosylation factor GTPase activation factors (ARF GAP) family, GIT1, and PKL/GIT2 directly bind paxillin and participate in Rac- and Rho-mediated signaling events at FA (32, 49, 58). In addition, the paxillin-dependent recruitment of GIT2 is also involved in the correct regulation of Rac activity at the cell leading edge (58). Conversely, GIT1 recruitment to paxillin-containing Rho type FA contributes to the disassembly of these structures through the displacement of paxillin (61).
AJ, composed of cadherins bound together in a homotypic and Ca2+-dependent fashion, serve to link adjacent EC, and through cytoplasmic tail, interact with the catenin family of intracellular proteins (
,
,
, p120), providing anchorage to the actin cytoskeleton (1). Rac and Cdc42 GTPases have been implicated in the assembly of these complexes. By binding its effector IQGAP1, Rac relieves inhibitory effect of IQGAP1 on vascular endothelial (VE)-cadherin-
-catenin interaction and promotes the assembly of a functional AJ protein complex containing E-cadherin,
-catenin, and
-catenin, which connects AJ to the cytoskeleton (15, 24, 35). In addition, Rac activity may be regulated by E-cadherin-mediated AJ assembly (24) and thus may be important for Rac-dependent enhancement of peripheral actin cytoskeleton and AJ and FA complexes resulting in increased EC barrier function.
We have previously reported potent barrier-protective effects of oxidized 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (OxPAPC) in human pulmonary EC and in animal models of lipopolysaccharide-induced acute lung injury and vascular hyperpermeability (4, 37). Effects of OxPAPC had been linked to the activation of small GTPases Rac and Cdc42, which mediated enhancement of peripheral F-actin cytoskeleton essential for EC barrier-protective response (4).
In this work, we studied remodeling of AJ and FA associated with barrier-protective response of human pulmonary EC to OxPAPC. With the use of subcellular fractionation, coimmunoprecipitation, and confocal microscopy, we examined potential interactions between components of FA: paxillin, GIT1, GIT2, and FAK, and components of AJ: VE-cadherin,
-,
-,
-, and p120-catenin. With the use of molecular approaches, we investigated involvement of Rac/Cdc42 pathway in the mechanisms of EC adhesion remodeling mediated by oxidized phospholipids.
 |
MATERIALS AND METHODS
|
|---|
Reagents and cell culture.
Antibodies to paxillin, FAK, GIT1, VE-cadherin, and
-,
-,
-, and p120-catenin were obtained from BD Transduction Laboratories (San Diego, CA), Rac1 and Cdc42 antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies to GIT2 were obtained from Novus Biologicals (Littleton, CO). Toxin B and Rac inhibitor NSC-23766 were purchased from Calbiochem (La Jolla, CA). All reagents used for immunofluorescence staining were purchased from Molecular Probes (Eugene, OR). Unless specified, all biochemical reagents, including 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (PAPC), were obtained from Sigma (St. Louis, MO). PAPC (Avanti Polar Lipids, Alabaster, AL) was oxidized by exposure of dry lipid to air as previously described (14, 30, 54). The extent of oxidation was monitored by positive ion electrospray mass spectrometry as described previously (54). Human pulmonary artery endothelial cells (HPAEC) were obtained from Cambrex (East Rutherford, NJ) and used at passages 59 as previously described (5).
Measurement of transendothelial electrical resistance.
Measurements of transendothelial electrical resistance (TER) across confluent HPAEC monolayers treated with OxPAPC were performed using electrical cell-substrate impedance sensing system (Applied Biophysics, Troy, NY), as we have previously described (4, 5, 7, 8). In selected experiments, total TER was resolved into components reflecting resistance between the basal surface of the cell and the electrode (
) and the resistance between adjacent cells (Rb) (27).
Depletion of
-catenin, paxillin, Rac, and Cdc42 in EC.
To deplete endogenous
-catenin, paxillin, Rac, or Cdc42, HPAEC were treated with gene-specific small interfering RNA (siRNA) duplexes described elsewhere (4, 52, 59). Predesigned siRNAs of standard purity were ordered from Ambion (Austin, TX), and transfection of EC with siRNA was performed as described previously (4, 8, 9). After 48 h, cells were harvested and used for experiments.
Immunofluorescence staining and image analysis.
EC grown on glass coverslips were stimulated with OxPAPC or left untreated, and immunofluorescence staining for proteins of interest was performed using corresponding antibodies as described elsewhere (4, 79). Confocal microscopy was performed using a Leica SP2A OBS Laser Scanning Confocal microscope, and images were processed with ImageJ software (National Institutes of Health, Bethesda, MD) and Adobe Photoshop 7.0 (Adobe Systems, San Jose, CA) software. Quantitative analysis of AJ was performed using MetaVue 4.6 (Universal Imaging, Downingtown, PA) software, as previously described (8, 12, 13).
Differential protein fractionation.
Confluent HPAEC were stimulated with OxPAPC, and after rapid wash with ice-cold PBS, cytosolic fraction was isolated by centrifugation using extraction buffer containing 50 mM Tris·HCl, pH 7.4, 100 mM NaCl, 0.01% digitonin, and protease/phosphatase inhibitor cocktail. Next, pellets were resuspended in extraction buffer containing 50 mM Tris·HCl, pH 7.4, 2% Triton X-100, 100 mM NaCl, and protease/phosphatase inhibitor cocktail and incubated on ice for 30 min. The membrane fraction was isolated by centrifugation (5 min, 16,000 g). Pellets containing cytoskeletal fraction were dissolved in 1x SDS sample buffer.
Coimmunoprecipitation and immunoblotting.
Coimmunoprecipitation studies were performed using confluent HPAEC as described previously (44, 46). Protein extracts were subjected to SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose membrane, and probed with antibodies of interest, as previously described (7, 44, 46). Intensities of immunoreactive protein bands were quantified using Image Quant software.
Subcloning of
-catenin and pulldown assay.
Total RNA from HPAECs was isolated by RNeasy Plus Mini Kit (Qiagen, Valencia, CA) and used for cDNA synthesis in RT reaction with Superscript III Reverse Transcriptase enzyme (Invitrogen, Carlsbad, CA). Primer pairs were designed for
-catenin gene (NM_001904
[GenBank]
.2): (5'ATGGCTACTCAAGCTGATTTGATGGAGT3'; 5'TTACAGGTCAGTATCAAACCAGGCCAG3'). Platinum PCR SuperMix High Fidelity (Invitrogen) was used then to amplify coding region of
-catenin using GeneAmp PCR System 9700 (Applied Biosystems). PCR product was cloned using pCR8/GW/Topo TA Cloning Kit (Invitrogen) according to the manufacturer's instructions followed by transfer into pDEST15 vector for bacterial expression (Invitrogen). The construct pDEST15-
-catenin was used for expression of NH2 terminus GST tagged
-catenin in BL21-AI Escherichia coli according to recommendations of E. coli Expression system Gateway Technology (Invitrogen). GST-fusion protein was isolated (53) using glutathione resin (Clontech Laboratories, Mountain View, CA) and stored as 50% glycerol slurry. Endothelial monolayers were washed with PBS and incubated on ice for 15 min with lysis buffer (50 mM Tris·HCl, pH 7.5, 150 mM NaCl, 1.5 mM MgCl2, 1 mM EDTA, 1% Triton X-100, and 10% glycerol). Lysate was clarified by centrifugation and incubated with glutathione resin (2 h, 4°C) loaded with GST-
-catenin. Then, resin was collected by centrifugation, washed three times with lysis buffer, and used for Western blot analysis.
Statistical analysis.
All measurements were performed in at least three independent experiments and presented as means ± SD. For comparison among groups, one-way ANOVA was performed. Differences were considered statistically significant at P < 0.05.
 |
RESULTS
|
|---|
OxPAPC-induced AJ remodeling in pulmonary EC.
Previous studies have shown that barrier-protective effects of sphingosine-1-phosphate, hepatocyte growth factor, or laminar shear stress on the pulmonary endothelium were associated with remodeling of AJ and FA (21, 31, 33, 38, 45). The results of this study show that stimulation of human pulmonary EC with OxPAPC (20 µg/ml, 30 min) dramatically increased EC junctional areas covered by AJ, as detected by immunofluorescent staining of OxPAPC-stimulated endothelial monolayers with
-catenin and VE-cadherin antibodies (Fig. 1A, right). Quantitative image analysis confirmed OxPAPC-induced increases in the areas covered by AJ (Fig. 1B). At early time points (15 min) of OxPAPC stimulation, increase in AJ area occurred mostly via cell spreading, leading to peripheral cell-cell overlay, whereas at later time points (1530 min), AJ localized more at the cell-cell interface areas. After 60120 min of OxPAPC treatment, the marker of AJ VE-cadherin was predominantly localized at the cell-cell interface areas (Fig. 1C). These data correlate well with the previously described OxPAPC-induced actin remodeling and robust lamellipodia formation at early time points of OxPAPC stimulation and formation of unique zip-like structures at later time points (4). To confirm the importance of AJ in the mediation of protective responses by OxPAPC, we analyzed cell-cell adhesion (Rb) and cell-matrix adhesion (
) using the electrical cell-substrate impedance sensing system (27). Our results indicate that OxPAPC-induced enhancement in EC electrical resistance is mediated by enhanced cell-cell interactions, as reflected by an increase in Rb component (Fig. 1D).
To examine a role of AJ proteins in development of OxPAPC-induced barrier-protective response in pulmonary EC, we depleted endogenous pool of
-catenin using transfection with
-catenin-specific siRNA. EC transfected with nonspecific RNA duplexes were used as controls. In that experiment, the basal transendothelial resistance of cell monolayers treated with
-catenin-specific siRNA was slightly lower (1,168+/77
) compared with cells transfected with nonspecific RNA (1,365+/84
). Depletion of
-catenin significantly attenuated OxPAPC barrier-protective effects on pulmonary EC (Fig. 1E). Downregulation of
-catenin expression was confirmed by Western blot analysis of EC treated with specific or nonspecific RNA (Fig. 1E, inset). These results indicate an essential role for AJ in the barrier-protective response of pulmonary EC to OxPAPC.
OxPAPC-induced FA remodeling in pulmonary EC.
We have previously described OxPAPC-induced phosphorylation of FA proteins paxillin and FAK (6). Immunofluorescence analysis of EC monolayers stimulated with OxPAPC (20 µg/ml, 30 min) showed pronounced peripheral translocation of FA proteins paxillin, FAK, GIT1, and GIT2 (Fig. 2A). Depletion of endogenous paxillin using the siRNA approach significantly reduced increases in TER caused by OxPAPC (20 µg/ml) (Fig. 2B). Suppression of paxillin expression was confirmed by Western blot analysis of EC treated with paxillin-specific or nonspecific RNA (Fig. 2B, inset). In these experiments, measurements of basal transendothelial resistance showed 1,048+/63
for EC monolayers treated with paxillin-specific siRNA and 1,220+/82
for EC transfected with nonspecific RNA.

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 2. OxPAPC induces focal adhesion (FA) remodeling. A: EC grown on glass coverslips were treated with OxPAPC (20 µg/ml, 30 min), and redistribution of paxillin, FA kinase (FAK), G protein-coupled receptor kinase interacting protein 1 (GIT1), and GIT2 was examined by immunofluorescent staining with corresponding antibodies as described in MATERIALS AND METHODS. Results are representative of 3 independent experiments. Bar = 10 µm. B: TER measurements were performed in human pulmonary EC transfected with paxillin-specific siRNA or nonspecific RNA duplexes followed by OxPAPC treatment (20 µg/ml). Paxillin protein depletion was confirmed by Western blot (inset). Control cells were treated with nonspecific RNA duplexes. Results are representative of 3 independent experiments.
|
|
OxPAPC induces subcellular redistribution of AJ and FA proteins.
HPAEC were treated with OxPAPC (20 µg/ml, 30 min) followed by differential fractionation of cell lysates to cytosolic, membrane, and cytoskeletal fractions, as described in MATERIALS AND METHODS. OxPAPC treatment significantly increased the content of AJ proteins in the membrane fraction concomitant with noticeable decreases of
-catenin and p120-catenin in the cytosolic fraction (Fig. 3A). Figure 3A, top, shows significant accumulation of VE-cadherin in the membrane fraction upon OxPAPC treatment. Consistent with VE-cadherin being a transmembrane AJ protein, its content in the cytosol even in nonstimulated EC was significantly lower than in the membrane fraction. VE-cadherin redistribution in cytosolic fractions was therefore detected by ECL techniques using longer exposure of autoradiography films and found to be decreased upon OxPAPC stimulation (data not shown). Equal levels of VE-cadherin expression in the control and OxPAPC-stimulated cells have been verified by Western blot of the total lysates from the same experiment (Fig. 3A). Importantly, OxPAPC induced redistribution of FA proteins paxillin, vinculin, FAK, GIT1, and GIT2, from cytosolic to the membrane/cytoskeletal fraction (Fig. 3B). Consistent with our previous report (4), OxPAPC induced translocation of Rac effector cortactin involved in enhancement of peripheral F-actin cytoskeleton (Fig. 3C). Control experiments showed that OxPAPC did not change subcellular distribution of Rho-associated kinase, which is not involved in the Rac/Cdc42 pathways of OxPAPC-mediated signaling (Fig. 3C, bottom).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3. OxPAPC induces membrane translocation of AJ and FA proteins. Human pulmonary EC were stimulated with OxPAPC (20 µg/ml, 30 min) or left untreated. Membrane (Memb) and cytosolic (CSL) fractions were isolated as described in MATERIALS AND METHODS. The content of AJ proteins (A), FA proteins (B), actin-binding protein cortactin and Rho-kinase (C) was determined by Western blot analysis of cytosolic and membrane fractions with specific antibodies. A, top, right depicts total lysates from the same experiment probed with VE-cadherin antibody. Results are representative of 3 independent experiments.
|
|
OxPAPC induces association of AJ and FA protein complexes.
Biochemical and immunofluorescence studies showed OxPAPC-induced coordinated peripheral redistribution of translocation of FA and AJ proteins as well as their accumulation in the membrane fraction after subcellular fractionation, suggesting potential interactions of FA and AJ complexes. With the use of coimmunoprecipitation studies, we tested association between FA and AJ proteins. In the initial set of experiments, we used antibodies to FA proteins paxillin, FAK, GIT1, and GIT2 for coimmunoprecipitation followed by Western blot detection of AJ proteins including VE-cadherin and
-,
-,
-, and p120-catenin in immunoprecipitates. Because preliminary experiments indicated the most pronounced interactions of paxillin with
-catenin upon OxPAPC (20 µg/ml, 30 min) stimulation and insignificant interactions of GIT1, GIT2, or FAK with AJ proteins (data not shown), coimmunoprecipitation assays with paxillin antibody were used in the further studies. OxPAPC stimulated interaction of paxillin with other members of FA protein complex: vinculin, GIT1, and GIT2 (Fig. 4A, top). Remarkably, OxPAPC induced association of paxillin with AJ proteins
-catenin,
-catenin, p120-catenin, and VE-cadherin (Fig. 4A, bottom), with the most pronounced increase in association between paxillin and
-catenin. Time-course coimmunoprecipitation studies demonstrated increased association of paxillin and
-catenin observed after 15 min of OxPAPC treatment, which remained markedly elevated for at least for 2 h after OxPAPC treatment (Fig. 4B). Our observations are highly consistent with immunofluorescence analysis showing increased AJ between adjacent cells after 30 min and further AJ enhancement observed at 60 min of OxPAPC stimulation (Fig. 1C).
Reverse coimmunoprecipitation experiments using antibodies to AJ proteins showed that only
-catenin exhibited strong OxPAPC-induced association with paxillin (Fig. 4C), whereas coimmunoprecipitation using antibodies to VE-cadherin (Fig. 4D),
-catenin (Fig. 4E), and p120-catenin (Fig. 4F) did not reveal significant paxillin increases in immune complexes, although OxPAPC-induced increases in the association of VE-cadherin,
-catenin, and p120-catenin with each other was still detected. These data suggest an indirect nature of paxillin association with the other AJ proteins and more pronounced paxillin-
-catenin interaction, which may mediate FA-AJ association in response to OxPAPC.
As a complementary approach for further characterization of paxillin-
-catenin interactions, we have cloned human
-catenin from human pulmonary EC and inserted obtained cDNA into pDEST15 vector for bacterial expression, as described in MATERIALS AND METHODS. The plasmid was further used for bacterial expression of NH2 terminus GST-tagged, full-length
-catenin. GST-tagged
-catenin was isolated using glutathione resin and used for pulldown assays with lysates from pulmonary EC, as described in MATERIALS AND METHODS. Endogenous paxillin interacted with immobilized
-catenin, as detected by Western blot, whereas no paxillin signal was detected in control experiments with cell lysates incubated with nonconjugated glutathione resin (Fig. 4G). Thus complementary approaches including direct and reverse coimmunoprecipitation assays and pulldown assays using immobilized recombinant
-catenin strongly suggest paxillin-
-catenin interactions.
OxPAPC induces colocalization of paxillin and
-catenin in the peripheral EC junctional complexes.
To further substantiate paxillin-
-catenin interaction, we used double immunofluorescence staining and confocal microscopy and analyzed paxillin and
-catenin colocalization in EC monolayers after OxPAPC stimulation (Fig. 5). Quiescent EC monolayers showed randomly distributed paxillin-positive FA and peripheral localization of
-catenin-positive AJ complexes (Fig. 5, A and B, left). Merged images showed no colocalization between paxillin and
-catenin (Fig. 5C, left). However, OxPAPC stimulation caused dramatic peripheral accumulation of paxillin-positive FA complexes accompanied by enhancement of AJ areas (Fig. 5, A and B, right). Remarkably, OxPAPC treatment also induced colocalization of paxillin and
-catenin at the cell-cell junctions of the EC monolayers (Fig. 5C).
Downregulation of
-catenin or paxillin attenuates OxPAPC-induced FA-AJ interactions and EC barrier enhancement.
The results described above show OxPAPC-induced colocalization of FA and AJ complexes at the cell periphery and enlargement of cell junction areas covered by AJ areas and link these effects to OxPAPC-induced stimulation of paxillin-
-catenin interactions. To further investigate a cross talk between paxillin and
-catenin, we depleted endogenous
-catenin using the siRNA approach. Depletion of
-catenin significantly attenuated OxPAPC-induced AJ enhancement, as detected by VE-cadherin staining (Fig. 6A). Remarkably, compared with EC transfected with nonspecific RNA or nontransfected cells,
-catenin depletion abolished the OxPAPC-induced peripheral translocation of paxillin (Fig. 6B). In addition, coimmunoprecipitation studies revealed dramatic attenuation of paxillin-VE-cadherin and paxillin-p120-catenin interactions upon OxPAPC challenge in pulmonary EC treated with
-catenin-specific siRNA (Fig. 6C).
We next tested effects of siRNA-induced paxillin knockdown on AJ enhancement caused by OxPAPC. Pretreatment of pulmonary EC with paxillin-specific siRNA markedly attenuated effects of OxPAPC on enlargement of AJ areas detected by immunofluorescence staining with
-catenin antibodies (Fig. 6D). Similar patterns were obtained in EC monolayers with depleted paxillin after OxPAPC treatment and staining with VE-cadherin antibodies (data not shown). Double knockdown of
-catenin and paxillin using cotransfection with corresponding siRNAs abolished OxPAPC-induced barrier-protective response in the pulmonary EC (Fig. 6E). In these experiments, cotransfection with specific siRNAs decreased the basal transendothelial resistance to 971+/73
compared with cells transfected with nonspecific RNA (1,250+/53
). Our summarized results suggest the critical role of
-catenin and paxillin in the pulmonary endothelial barrier regulation by OxPAPC.
Rac and Cdc42 inhibition abolishes EC barrier-protective response and OxPAPC-induced association of FA and AJ proteins.
Previous studies determined a key role of Rac- and Cdc42-dependent mechanisms in the EC cytoskeletal remodeling and barrier-protective response induced by oxidized phospholipids (4). Consistent with previous results, preincubation of EC with pharmacological Rac inhibitor NSC-23766 (200 µM, 45 min) significantly attenuated OxPAPC-induced increases in transendothelial resistance (Fig. 7A). NSC-23766 pretreatment did not affect the basal transendothelial resistance (1,629+/83 compared with 1,687+/115 in nontreated cells). Combined depletion of endogenous Rac and Cdc42 achieved by cotransfection of EC with Rac- and Cdc42-specific siRNA completely abolished OxPAPC-induced EC barrier enhancement monitored by TER increases compared with control EC transfected with nonspecific RNA duplexes (Fig. 7B). In these experiments, cotransfection with Rac- and Cdc42-specific siRNAs decreased the basal transendothelial resistance to 1,201+/94
compared with cells transfected with nonspecific RNA (1,439+/102
). Next, studies addressed the role of Rac/Cdc42-dependent pathways in the OxPAPC-mediated remodeling of FA and AJ. Pulmonary EC were pretreated with a general Rac, Rho, and Cdc42 inhibitor from Clostridium difficile toxin B (20 ng/ml) followed by OxPAPC stimulation (20 µg/ml, 30 min) and subcellular fractionation analysis. Pretreatment with toxin B significantly attenuated OxPAPC-induced translocation of Rac-regulated actin binding protein cortactin, FA protein paxillin, and AJ proteins
-catenin and VE-cadherin to the membrane fraction (Fig. 7C). To further investigate the involvement of Rac and Cdc42 in OxPAPC-mediated FA-AJ interactions, pulmonary EC were cotransfected with Rac- and Cdc42-specific siRNA followed by coimmunoprecipitation assays. Rac/Cdc42 downregulation dramatically attenuated OxPAPC-induced association between paxillin and AJ proteins
-catenin,
-catenin, and VE-cadherin (Fig. 7D).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 7. Inactivation of Rac/Cdc42 pathway abolishes OxPAPC-induced EC barrier-protective response and AJ and FA protein association. A: EC monolayers were preincubated with Rac inhibitor (RacInh) NSC-23766 (2 x 104 mol/l, 45 min) at the time indicated by the 1st arrow, stimulated with OxPAPC (20 µg/ml) as indicated by the 2nd arrow, and measurements of TER were performed over time. B: after depletion of endogenous Rac and Cdc42 using cotransfection with Rac and Cdc42-specific siRNAs, EC were stimulated with OxPAPC (shown by arrow), and TER was monitored over time. Control cells were treated with nonspecific RNA. Inset represents results of Western blot analysis confirming Rac and Cdc42 protein depletion compared with EC treatment with nonspecific RNA. C: EC were preincubated with Clostridium difficile toxin B (TB+; 20 ng/ml, 2 h) followed by OxPAPC treatment (20 µg/ml, 30 min) or left untreated, and FA- and AJ-specific protein content in cytosolic and membrane fractions from stimulated and unstimulated EC was determined by Western blot analysis as described in MATERIALS AND METHODS. D: EC cotransfected with Rac- and Cdc42-specific siRNA or treated with nonspecific RNA were stimulated with OxPAPC (20 µg/ml, 30 min) followed by coimmunoprecipitation with paxillin antibodies. Association of paxillin with -catenin, -catenin, and VE-cadherin was examined by Western blot. Equal protein loadings were confirmed by membrane reprobing with paxillin antibody. Results are representative of 3 independent experiments.
|
|
Rac and Cdc42 inhibition abolishes OxPAPC-induced colocalization of paxillin and
-catenin in the peripheral EC junctional complexes.
To further substantiate a role of Rac/Cdc42-dependent mechanism in the regulation of OxPAPC-induced cytoskeletal remodeling and rearrangement of FA and AJ, we performed immunofluorescence studies. Rac and Cdc42 depletion obtained by cotransfection of pulmonary EC with Rac- and Cdc42-specific siRNA abolished peripheral accumulation of actin in response to OxPAPC (20 µg/ml, 30 min) compared with EC transfected with nonspecific RNA (Fig. 8A). Furthermore, depletion of Rac and Cdc42 prevented OxPAPC-induced enlargement of AJ areas detected by immunofluorescence staining for the AJ protein VE-cadherin (Fig. 8B). Finally, using double immunofluorescence staining for paxillin and
-catenin followed by laser confocal microscopy analysis, we examined effects of Rac/Cdc42 downregulation on the colocalization of FA and AJ complexes in the OxPAPC-treated EC monolayers. EC transfection with siRac/Cdc42 not only attenuated OxPAPC-induced peripheral translocation of the FA protein paxillin and accumulation of AJ component
-catenin in the areas of cellular contacts, but also inhibited paxillin/
-catenin colocalization (Fig. 8C) compared with EC treated with nonspecific RNA (Fig. 8C, right) or nontransfected cells (Fig. 5C).
 |
DISCUSSION
|
|---|
The main finding of this study is OxPAPC-induced enhancement of AJ and dramatic peripheral redistribution of FA, which results in novel interactions between FA and AJ complexes via paxillin binding to
-catenin and promotes barrier-protective endothelial response to OxPAPC. Furthermore, our results show a critical role for Rac and Cdc42 small GTPases in the initiation of FA-AJ interactions observed in OxPAPC-stimulated endothelial monolayers.
Endothelial AJ formed by homotypic interactions between VE-cadherins from adjacent cells also induce VE-cadherin association with the catenin family of intracellular proteins, which provide anchorage to the actin cytoskeleton (1). These interactions play a critical role in the maintenance of EC monolayer integrity and regulation of paracellular permeability. Dynamics of AJ complexes are precisely regulated by small GTPases. Rho activation induces disruption of intercellular VE-cadherin interactions and disassembly of VE-cadherin/
-catenin/
-catenin complexes resulting in EC barrier compromise (7, 17, 28). In contrast, Rac promotes assembly of AJ complexes (15, 24, 35) in part via blocking the negative effects of Rac/Cdc-42 effector IQGAP on VE-cadherin-
-catenin interactions (24). Consistent with the role of Rac in promoting AJ assembly, our results show that enlargement of the areas covered by AJ and increased interactions between VE-cadherin and
-
-
-p120-catenin complex in the OxPAPC-stimulated EC were associated with OxPAPC-induced barrier-protective effects and mediated by Rac/Cdc42. These findings are highly consistent with the previous studies indicating an essential role of Rac and Cdc42 in the mechanisms underlying the barrier-protective effects of oxidized phospholipids (4, 10, 11). Maintenance of cadherin-based adhesions may be also regulated by other mechanisms including tyrosine phosphorylation of VE-cadherin,
-catenin, and p120-catenin, protein kinase A, and recently described cAMP-activated Epac-Rap-Tiam1-Rac pathway (20, 23, 25, 60). Further studies are required to test a role of these mechanisms in the OxPAPC-induced AJ remodeling and EC barrier protection.
Our data demonstrate dramatic Rac/Cdc42-dependent peripheral redistribution of FA complexes in OxPAPC-stimulated EC monolayers, which was associated with increased EC barrier properties. Although the major components of the FA protein complexes have been described, and signal pathways leading to FA assembly have been characterized (19, 26, 39, 42, 43), the mechanisms driving FA peripheral redistribution are much less explored. Recent studies suggest a mechanism for peripheral translocation of paxillin-GIT1-
PIX-PAK1 complex, which involves phosphorylation of paxillin at Ser273 and GIT1 at Ser709 mediated by the Rac effector PAK1 (36, 55). In addition, activation of Cdc42 and Rac1, but not RhoA, stimulates the translocation of PAK1 and GIT2 from a generally diffuse localization to the newly formed FA (16). These findings suggest a potential molecular mechanism of Rac-dependent FA peripheral redistribution in OxPAPC-stimulated EC.
Few recent reports indicate an important and perhaps underappreciated functional cross talk between cell-matrix and cell-cell adhesion molecules. FA-associated tyrosine kinase FAK controls remodeling of the AJ, which is essential for EC monolayer reparation by promoting the recovery of peripheral E-cadherin (41), whereas FAK phosphorylation on Src-specific sites is required for Src-induced deregulation of E-cadherin (2) and thus may play a bifunctional role in AJ assembly-disassembly (47). Furthermore, vinculin was found in both cell-cell (AJ) and cell-matrix (FA) junctions (57), where it could mediate the linkage of cadherins or integrins to the actin cytoskeleton (40). Vinculin interaction with the AJ protein
-catenin has been also reported, but its functional role is not yet well understood (40, 57). Thus published studies suggest involvement of FAK, integrins, and vinculin in the AJ regulation; however, direct association between FA and AJ complexes has not been explored.
The most striking finding of this study is OxPAPC-induced associations between FA and AJ complexes. Results of direct and reverse coimmunoprecipitation experiments show the most pronounced interaction between
-catenin and paxillin. Furthermore, the time course of OxPAPC-induced
-catenin-paxillin interaction corresponded to remodeling and colocalization of FA and AJ and development of EC barrier-protective response. The interaction between
-catenin and paxillin is novel, and its mechanism is totally unexplored.
-Catenin binds VE-cadherin through its central armadillo repeats and interacts with
-catenin through the NH2-terminal domain. In turn,
-catenin links AJ protein complex to the actin cytoskeleton (18). Because
-catenin did not coprecipitate with paxillin complexes in OxPAPC-treated EC, it is unlikely that paxillin associated with
-catenin via
-catenin-dependent cytoskeletal linkage between FA and AJ complexes. However, other binding partners mediating
-catenin-paxillin interactions cannot be excluded. Paxillin is a multidomain adapter FA protein and may interact through the multiple SH2- and SH3-binding domains, LIM, and LD motifs with other structural and signaling proteins, and future studies using deletion and site-directed mutagenesis approach will delineate specific domain(s) and potential paxillin and
-catenin phosphorylation sites, which promote integration of FA and AJ complexes through
-catenin-paxillin interactions.
Our results show that Rac/Cdc42 inhibition abolished
-catenin-paxillin interaction and colocalization of AJ and FA at the cell periphery. Importantly, molecular inhibition of Rac and Cdc42 abolished OxPAPC-induced coimmunoprecipitation of paxillin with three tested AJ proteins:
-catenin,
-catenin, and VE-cadherin (Fig. 6D). These results indicate that OxPAPC stimulation likely promotes paxillin interaction with the entire AJ complex rather than with AJ-unbound cytosolic
-catenin pool. Although the exact role of Rac/Cdc42 signaling in this process is unclear, we speculate that
-catenin-paxillin interaction may be a two-step process. The first step may include Rac/Cdc42-mediated peripheral translocation of FA proteins to the cell periphery, which is required for the formation of peripheral FA contacts. In the second step, FA localized to cell periphery initiate interactions with AJ complexes via
-catenin-paxillin association. We also cannot exclude other paxillin-associated Rac/Cdc42 effectors that may mediate paxillin interaction with
-catenin.
The results of confocal microscopy also suggest that only a portion of peripherally localized FA complexes interact with AJ. We speculate that AJ-unbound pool of FA forms a peripheral ring of cell-substrate adhesions, which provide cell tethering to the substrate, whereas AJ-bound pool of FA integrates cell-cell and cell-substrate adhesive complexes, which may provide an additional structural basis for enhanced barrier-properties of OxPAPC-stimulated EC monolayers. Moreover, FA-AJ interactions may determine a particular pattern of peripheral actin organization observed in OxPAPC-stimulated EC monolayers and thus further integrate cell adhesions and peripheral actin cytoskeleton.
Based on our data and previous studies, we propose a hypothetical mechanism of EC barrier regulation by FA-AJ interactions (Fig. 9). OxPAPC-induced activation of Rac/Cdc42 signaling results in enhancement of AJ complexes and peripheral redistribution of FA and integrates FA and AJ complexes via interactions between
-catenin and paxillin. Together with previously described dramatic enhancement of peripheral actin cytoskeleton (4), these events result in formation of an endothelial "double rim of defense," which secures paracellular flux of solutes and macromolecules controlled by AJ and limits influx between cells and basal membrane by forming peripheral FA rim and FA-AJ interactions. These studies provide a novel insight into regulation of endothelial permeability via interactions between FA and AJ protein complexes orchestrated by small GTPases Rac and Cdc42.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 9. Schematic presentation of OxPAPC-induced EC contact remodeling and interactions between FA and AJ. In nonstimulated EC monolayers, AJ complexes regulate basal levels of paracellular permeability, whereas randomly distributed FA serve to maintain cell-substrate adhesion and determine the pattern of actin cytoskeletal arrangement observed under nonstimulated conditions by providing attachment sites for actin filaments. OxPAPC stimulation causes Rac/Cdc42-dependent peripheral translocation of FA complexes and increased association of paxillin (PAX), FAK, vinculin (Vinc), GIT1 (G1), and GIT2 (G2) also associated with enhancement of peripheral actin cytoskeleton. In addition, OxPAPC enhances cell-cell adhesions by increasing the areas covered by AJ complexes and increased interactions between VE-cadherin (VEC) and - - -p120-catenins. This cell adhesion remodeling is also accompanied by OxPAPC-induced, Rac/Cdc42-mediated stimulation of paxillin- -catenin protein interactions, which integrate AJ and peripheral FA complexes, link cell-adhesive complexes to peripheral cytoskeleton, and thus determine the EC barrier-protective response to OxPAPC.
|
|
 |
GRANTS
|
|---|
This work was supported by National Heart, Lung, and Blood Institute Grants HL-076259 and HL-075349. A. A. Birukova is a recipient of the American Heart Association National Scientist Development Grant.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Nurgul Moldobaeva for superb laboratory assistance and Tatiana Zagranichnaya for technical assistance with confocal microscopy.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: K. G. Birukov, Section of Pulmonary and Critical Medicine, Dept. of Medicine, Univ. of Chicago, 929 East 57th St., CIS Bldg., W410, Chicago, IL 60637 (e-mail: kbirukov{at}medicine.bsd.uchicago.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Aberle H, Schwartz H, Kemler R. Cadherin-catenin complex: protein interactions and their implications for cadherin function. J Cell Biochem 61: 514523, 1996.[CrossRef][ISI][Medline]
- Avizienyte E, Wyke AW, Jones RJ, McLean GW, Westhoff MA, Brunton VG, Frame MC. Src-induced de-regulation of E-cadherin in colon cancer cells requires integrin signalling. Nat Cell Biol 4: 632638, 2002.[ISI][Medline]
- Birukov KG, Birukova AA, Dudek SM, Verin AD, Crow MT, Zhan X, DePaola N, Garcia JG. Shear stress-mediated cytoskeletal remodeling and cortactin translocation in pulmonary endothelial cells. Am J Respir Cell Mol Biol 26: 453464, 2002.[Abstract/Free Full Text]
- Birukov KG, Bochkov VN, Birukova AA, Kawkitinarong K, Rios A, Leitner A, Verin AD, Bokoch GM, Leitinger N, Garcia JG. Epoxycyclopentenone-containing oxidized phospholipids restore endothelial barrier function via Cdc42 and Rac. Circ Res 95: 892901, 2004.[Abstract/Free Full Text]
- Birukov KG, Jacobson JR, Flores AA, Ye SQ, Birukova AA, Verin AD, Garcia JG. Magnitude-dependent regulation of pulmonary endothelial cell barrier function by cyclic stretch. Am J Physiol Lung Cell Mol Physiol 285: L785L797, 2003.[Abstract/Free Full Text]
- Birukov KG, Leitinger N, Bochkov VN, Garcia JG. Signal transduction pathways activated in human pulmonary endothelial cells by OxPAPC, a bioactive component of oxidized lipoproteins. Microvasc Res 67: 1828, 2004.[CrossRef][ISI][Medline]
- Birukova AA, Adyshev D, Gorshkov B, Bokoch GM, Birukov KG, Verin AA. GEF-H1 is involved in agonist-induced human pulmonary endothelial barrier dysfunction. Am J Physiol Lung Cell Mol Physiol 290: L540L548, 2006.[Abstract/Free Full Text]
- Birukova AA, Birukov KG, Smurova K, Adyshev DM, Kaibuchi K, Alieva I, Garcia JG, Verin AD. Novel role of microtubules in thrombin-induced endothelial barrier dysfunction. FASEB J 18: 18791890, 2004.[Abstract/Free Full Text]
- Birukova AA, Chatchavalvanich S, Rios A, Kawkitinarong K, Garcia JG, Birukov KG. Differential regulation of pulmonary endothelial monolayer integrity by varying degrees of cyclic stretch. Am J Pathol 168: 17491761, 2006.[Abstract/Free Full Text]
- Birukova AA, Fu P, Chatchavalvanich S, Burdette D, Oskolkova O, Bochkov VN, Birukov KG. Polar head groups are important for barrier protective effects of oxidized phospholipids on pulmonary endothelium. Am J Physiol Lung Cell Mol Physiol 292: L924L935, 2007.[Abstract/Free Full Text]
- Birukova AA, Malyukova I, Mikaelyan A, Fu P, Birukov KG. Tiam1 and betaPIX mediate Rac-dependent endothelial barrier protective response to oxidized phospholipids. J Cell Physiol 211: 608617, 2007.[CrossRef][ISI][Medline]
- Birukova AA, Smurova K, Birukov KG, Kaibuchi K, Garcia JGN, Verin AD. Role of Rho GTPases in thrombin-induced lung vascular endothelial cells barrier dysfunction. Microvasc Res 67: 6477, 2004.[CrossRef][ISI][Medline]
- Birukova AA, Smurova K, Birukov KG, Usatyuk P, Liu F, Kaibuchi K, Ricks-Cord A, Natarajan V, Alieva I, Garcia JG, Verin AD. Microtubule disassembly induces cytoskeletal remodeling and lung vascular barrier dysfunction: role of Rho-dependent mechanisms. J Cell Physiol 201: 5570, 2004.[CrossRef][ISI][Medline]
- Bochkov VN, Mechtcheriakova D, Lucerna M, Huber J, Malli R, Graier WF, Hofer E, Binder BR, Leitinger N. Oxidized phospholipids stimulate tissue factor expression in human endothelial cells via activation of ERK/EGR-1 and Ca2+/NFAT. Blood 99: 199206, 2002.[Abstract/Free Full Text]
- Braga VM, Del Maschio A, Machesky L, Dejana E. Regulation of cadherin function by Rho and Rac: modulation by junction maturation and cellular context. Mol Biol Cell 10: 922, 1999.[Abstract/Free Full Text]
- Brown MC, West KA, Turner CE. Paxillin-dependent paxillin kinase linker and p21-activated kinase localization to focal adhesions involves a multistep activation pathway. Mol Biol Cell 13: 15501565, 2002.[Abstract/Free Full Text]
- Carbajal JM, Gratrix ML, Yu CH, Schaeffer RC Jr. ROCK mediates thrombin's endothelial barrier dysfunction. Am J Physiol Cell Physiol 279: C195C204, 2000.[Abstract/Free Full Text]
- Coates JC. Armadillo repeat proteins: beyond the animal kingdom. Trends Cell Biol 13: 463471, 2003.[CrossRef][ISI][Medline]
- Critchley DR. Focal adhesionsthe cytoskeletal connection. Curr Opin Cell Biol 12: 133139, 2000.[CrossRef][ISI][Medline]
- Cullere X, Shaw SK, Andersson L, Hirahashi J, Luscinskas FW, Mayadas TN. Regulation of vascular endothelial barrier function by Epac, a cAMP-activated exchange factor for Rap GTPase. Blood 105: 19501955, 2005.[Abstract/Free Full Text]
- Dejana E. Endothelial adherens junctions: implications in the control of vascular permeability and angiogenesis. J Clin Invest 100: S7S10, 1997.[ISI][Medline]
- Dudek SM, Garcia JG. Cytoskeletal regulation of pulmonary vascular permeability. J Appl Physiol 91: 14871500, 2001.[Abstract/Free Full Text]
- Esser S, Lampugnani MG, Corada M, Dejana E, Risau W. Vascular endothelial growth factor induces VE-cadherin tyrosine phosphorylation in endothelial cells. J Cell Sci 111: 18531865, 1998.[Abstract]
- Fukata M, Kaibuchi K. Rho-family GTPases in cadherin-mediated cell-cell adhesion. Nat Rev Mol Cell Biol 2: 887897, 2001.[CrossRef][ISI][Medline]
- Fukuhara S, Sakurai A, Sano H, Yamagishi A, Somekawa S, Takakura N, Saito Y, Kangawa K, Mochizuki N. Cyclic AMP potentiates vascular endothelial cadherin-mediated cell-cell contact to enhance endothelial barrier function through an Epac-Rap1 signaling pathway. Mol Cell Biol 25: 136146, 2005.[Abstract/Free Full Text]
- Geiger B, Bershadsky A. Assembly and mechanosensory function of focal contacts. Curr Opin Cell Biol 13: 584592, 2001.[CrossRef][ISI][Medline]
- Giaever I, Keese CR. Micromotion of mammalian cells measured electrically. Proc Natl Acad Sci USA 88: 78967900, 1991.[Abstract/Free Full Text]
- Iyer S, Ferreri DM, DeCocco NC, Minnear FL, Vincent PA. VE-cadherin-p120 interaction is required for maintenance of endothelial barrier function. Am J Physiol Lung Cell Mol Physiol 286: L1143L1153, 2004.[Abstract/Free Full Text]
- Lee MJ, Thangada S, Claffey KP, Ancellin N, Liu CH, Kluk M, Volpi M, Sha'afi RI, Hla T. Vascular endothelial cell adherens junction assembly and morphogenesis induced by sphingosine-1-phosphate. Cell 99: 301312, 1999.[CrossRef][ISI][Medline]
- Leitinger N, Tyner TR, Oslund L, Rizza C, Subbanagounder G, Lee H, Shih PT, Mackman N, Tigyi G, Territo MC, Berliner JA, Vora DK. Structurally similar oxidized phospholipids differentially regulate endothelial binding of monocytes and neutrophils. Proc Natl Acad Sci USA 96: 1201012015, 1999.[Abstract/Free Full Text]
- Liu F, Schaphorst KL, Verin AD, Jacobs K, Birukova A, Day RM, Bogatcheva N, Bottaro DP, Garcia JG. Hepatocyte growth factor enhances endothelial cell barrier function and cortical cytoskeletal rearrangement: potential role of glycogen synthase kinase-3beta. FASEB J 16: 950962, 2002.[Abstract/Free Full Text]
- Mazaki Y, Hashimoto S, Okawa K, Tsubouchi A, Nakamura K, Yagi R, Yano H, Kondo A, Iwamatsu A, Mizoguchi A, Sabe H. An ADP-ribosylation factor GTPase-activating protein Git2- short/KIAA0148 is involved in subcellular localization of paxillin and actin cytoskeletal organization. Mol Biol Cell 12: 645662, 2001.[Abstract/Free Full Text]
- Mehta D, Konstantoulaki M, Ahmmed GU, Malik AB. Sphingosine 1-phosphate-induced mobilization of intracellular Ca2+ mediates rac activation and adherens junction assembly in endothelial cells. J Biol Chem 280: 1732017328, 2005.[Abstract/Free Full Text]
- Mehta D, Malik AB. Signaling mechanisms regulating endothelial permeability. Physiol Rev 86: 279367, 2006.[Abstract/Free Full Text]
- Nakagawa M, Fukata M, Yamaga M, Itoh N, Kaibuchi K. Recruitment and activation of Rac1 by the formation of E-cadherin-mediated cell-cell adhesion sites. J Cell Sci 114: 18291838, 2001.[Abstract]
- Nayal A, Webb DJ, Brown CM, Schaefer EM, Vicente-Manzanares M, Horwitz AR. Paxillin phosphorylation at Ser273 localizes a GIT1-PIX-PAK complex and regulates adhesion and protrusion dynamics. J Cell Biol 173: 587599, 2006.[Abstract/Free Full Text]
- Nonas SA, Miller I, Kawkitinarong K, Chatchavalvanich S, Gorshkova I, Bochkov VN, Leitinger N, Natarajan V, Garcia JG, Birukov KG. Oxidized phospholipids reduce vascular leak and inflammation in rat model of acute lung injury. Am J Respir Crit Care Med 173: 11301138, 2006.[Abstract/Free Full Text]
- Noria S, Cowan DB, Gotlieb AI, Langille BL. Transient and steady-state effects of shear stress on endothelial cell adherens junctions. Circ Res 85: 504514, 1999.[Abstract/Free Full Text]
- Petit V, Thiery JP. Focal adhesions: structure and dynamics. Biol Cell 92: 477494, 2000.[CrossRef][ISI][Medline]
- Pokutta S, Weis WI. The cytoplasmic face of cell contact sites. Curr Opin Struct Biol 12: 255262, 2002.[CrossRef][ISI][Medline]
- Quadri SK, Bhattacharya J. Resealing of endothelial junctions by focal adhesion kinase. Am J Physiol Lung Cell Mol Physiol 292: L334L342, 2007.[Abstract/Free Full Text]
- Romer LH, Birukov KG, Garcia JG. Focal adhesions: paradigm for a signaling nexus. Circ Res 98: 606616, 2006.[Abstract/Free Full Text]
- Schaller MD. Biochemical signals and biological responses elicited by the focal adhesion kinase. Biochim Biophys Acta 1540: 121, 2001.[Medline]
- Shikata Y, Birukov KG, Birukova AA, Verin AD, Garcia JG. Involvement of site-specific FAK phosphorylation in sphingosine-1 phosphate- and thrombin-induced focal adhesion remodeling: role of Src and GIT. FASEB J 17: 22402249, 2003.[Abstract/Free Full Text]
- Shikata Y, Birukov KG, Garcia JG. S1P induces FA remodeling in human pulmonary endothelial cells: role of Rac, GIT1, FAK and paxillin. J Appl Physiol 94: 11931203, 2003.[Abstract/Free Full Text]
- Shikata Y, Rios A, Kawkitinarong K, DePaola N, Garcia JG, Birukov KG. Differential effects of shear stress and cyclic stretch on focal adhesion remodeling, site-specific FAK phosphorylation, and small GTPases in human lung endothelial cells. Exp Cell Res 304: 4049, 2005.[CrossRef][ISI][Medline]
- Siu MK, Mruk DD, Lee WM, Cheng CY. Adhering junction dynamics in the testis are regulated by an interplay of beta 1-integrin and focal adhesion complex-associated proteins. Endocrinology 144: 21412163, 2003.[Abstract/Free Full Text]
- Turner CE. Paxillin and focal adhesion signalling. Nat Cell Biol 2: E231E236, 2000.[CrossRef][ISI][Medline]
- Turner CE, West KA, Brown MC. Paxillin-ARF GAP signaling and the cytoskeleton. Curr Opin Cell Biol 13: 593599, 2001.[CrossRef][ISI][Medline]
- Tzima E, Del Pozo MA, Kiosses WB, Mohamed SA, Li S, Chien S, Schwartz MA. Activation of Rac1 by shear stress in endothelial cells mediates both cytoskeletal reorganization and effects on gene expression. EMBO J 21: 67916800, 2002.[CrossRef][ISI][Medline]
- Ukropec JA, Hollinger MK, Woolkalis MJ. Regulation of VE-cadherin linkage to the cytoskeleton in endothelial cells exposed to fluid shear stress. Exp Cell Res 273: 240247, 2002.[CrossRef][ISI][Medline]
- Verma UN, Surabhi RM, Schmaltieg A, Becerra C, Gaynor RB. Small interfering RNAs directed against beta-catenin inhibit the in vitro and in vivo growth of colon cancer cells. Clin Cancer Res 9: 12911300, 2003.[Abstract/Free Full Text]
- Vikis HG, Guan KL. Glutathione-S-transferase-fusion based assays for studying protein-protein interactions. Methods Mol Biol 261: 175186, 2004.[Medline]
- Watson AD, Leitinger N, Navab M, Faull KF, Horkko S, Witztum JL, Palinski W, Schwenke D, Salomon RG, Sha W, Subbanagounder G, Fogelman AM, Berliner JA. Structural identification by mass spectrometry of oxidized phospholipids in minimally oxidized low density lipoprotein that induce monocyte/endothelial interactions and evidence for their presence in vivo. J Biol Chem 272: 1359713607, 1997.[Abstract/Free Full Text]
- Webb DJ, Kovalenko M, Whitmore L, Horwitz AF. Phosphorylation of serine 709 in GIT1 regulates protrusive activity in cells. Biochem Biophys Res Commun 346: 12841288, 2006.[CrossRef][ISI][Medline]
- Webb DJ, Parsons JT, Horwitz AF. Adhesion assembly, disassembly and turnover in migrating cellsover and over and over again. Nat Cell Biol 4: E97E100, 2002.[CrossRef][ISI][Medline]
- Weiss EE, Kroemker M, Rudiger AH, Jockusch BM, Rudiger M. Vinculin is part