|
|
||||||||
1Center for Lung Regeneration, Department of Environmental and Occupational Health, Graduate School of Public Health, University of Pittsburgh, Pittsburgh, Pennsylvania; and 2Division of Pulmonary and Critical Care Medicine, University of California at Davis, Davis, California
Submitted 5 September 2006 ; accepted in final form 10 May 2007
| ABSTRACT |
|---|
|
|
|---|
B, VDR, ISRE, and RSRFC4, were involved in MAPK signaling pathways. The NF-
B family, which is involved in inflammation-induced gene activation, was selected for further study to characterize TS exposure-induced transcriptional activation. Western blot analysis and immunofluorescence microscopy indicated that TS exposure induced phosphorylation of I
B and translocation of NF-
B p65/p50 heterodimers into the nucleus. This activity was abrogated by the MAPK inhibitors PD98059 and U0126. Our results confirmed that activation of MAPK signaling pathways by TS exposure increased transcriptional activity of NF-
B. These data provide a potential mechanism for TS-induced inflammatory gene expression.
tobacco smoke; transcription factor; MAPK; NF-
B
TS is a chemical mixture that contains more than 2,000 chemicals, free radicals, and oxidant molecules (6, 12). Each component potentially stimulates a variety of signal cascades. Previous studies suggested that TS regulates the expression of AP-1, NF-
B, and Smad (1, 6, 16, 17). Unfortunately, this conventional EMSA approach, which confirms DNA binding activity of a single TF at a time, limits our ability to understand the complex signaling interactions that likely occur after TS exposure. To address this issue, we applied protein/DNA array technology to screen multiple TFs that were affected by TS exposure. This array-based screening technology allowed us to detect activation of 244 different TFs simultaneously.
Our data suggest that the majority of TS-induced TFs are regulated by upstream MAPK signaling pathways. MAPKs are members of a ubiquitous protein serine/threonine kinase family responsible for signal transduction in eukaryotic organisms. The major kinase cascades of the MAPK family include ERK, JNK, and p38 MAPK. These signaling cascades commonly affect TF activation involved in cell proliferation, differentiation, and apoptosis. On the basis of reports that ERK 1/2 signaling pathways are involved in transcriptional control of TS-induced gene expression (6, 11, 21), we further examined how inhibition of ERK 1/2 affects the DNA binding activities of TS-regulated TFs. Specifically, we examined how the ERK 1/2 pathway may regulate NF-
B activation and nuclear translocation after TS exposure.
| Glossary |
|---|
|
|
|---|
B
| MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents.
The chemical inhibitor U0126 was purchased from Promega (Madison, WI). PD98059 was purchased from Axxora (San Diego, CA). All other chemicals were from Sigma (St. Louis, MO). Antibodies specific to ERK 1/2 and NF-
B were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies specific to phospho-ERK 1/2 was purchased from Cell Signaling Technology (Beverly, MA). Anti-GAPDH antibody was purchased from Novus Biologicals (Littleton, CO).
In vitro TS exposure. Research-grade 2R1 cigarettes without filters were obtained from the University of Kentucky Tobacco Research and Development Center (Lexington, KY). Cells were grown in either 12.5-cm2 (for transfections) or 25-cm2 (for protein and RNA isolation) Falcon flasks (Becton Dickinson, Franklin Lakes, NJ) to 80% confluence, serum starved for 16 h, and then exposed to mainstream TS as described previously (18). Briefly, TS (30 ml) was drawn into a syringe-driven device fitted with a tube. TS was delivered via the tube into cell culture flasks that were inverted to expose cells directly to smoke for 3 min. The flasks were restored to their original orientation, so that the cells were covered with culture medium without serum, and the flasks were placed in the 37°C incubator with 5% CO2. Cells were harvested after a 1.5-h TS-treatment period and 3-h recovery period followed by extraction of nuclear proteins.
Nuclear protein extraction.
Nuclear protein extraction from cells were prepared by using the NE-PER nuclear and cytoplasmic extraction kit (Pierce Biotechnology, Rockford, IL) according to the user's manual. Briefly, cells were washed twice with cold phosphate-buffered saline (PBS) and cell pellets were collected by centrifugation at 500 g for 3 min. Ice-cold reagent cytoplasmic extract reagent I (CERI; 200 µl) was added to the pellets and vigorously vortexed for 15 s. After incubation on ice for 10 min, 11 µl of ice-cold CERII was added into the traction and incubated on ice for 1 min. After centrifugation at >16,000 g for 5 min, the supernatant was collected as the cytoplasmic fraction. The insoluble pellet, which contained nuclei, was resuspended in 100 µl ice-cold NER and votexed for 15 s, incubated on ice with repeat votexing every 5 min, for a total of 40 min. After 40 min, the reaction was centrifuged at
16,000 g, and the supernatants were collected as the nuclear protein extraction.
Protein/DNA array screening. Protein/DNA array were carried out with a TranSignal protein/DNA array kit (Panomics, Redwood City, CA) according to the user's manual. Briefly, 25 µg of nuclear extract was incubated with biotin-labeled DNA probes mix in binding buffer for 30 min at 15°C. Protein/DNA complexes were loaded on 2% agarose gel and electrophoresed at 120 V in 0.5x Tris-buffered saline (TBS) for 20 min. The DNA probes were recovered from the excised gel and denatured at 95°C for 3 min before being hybridized to array membrane at 42°C overnight. The membrane was then washed twice in 2x SSC/0.5% SDS at 42°C for 20 min and twice in 0.1x SSC/0.5% SDS at 42°C for 20 min. The probes were detected with streptavidin-horseradish peroxidase (HRP) conjugate and visualized with SuperSignal chemiluminescence reagent (Pierce). The results were subjected to quantitative analysis, and those TFs with twofold changes compared with that of control were identified as candidates for confirmation by EMSA.
EMSA.
Cells were exposed to TS, nuclear extracts were prepared, and EMSA were performed using biotin-labeled double-stranded consensus probes. The probes sequences were as follows: GATA, CACTTGATAACAGAAAGTGATAACTCT; NF-
B, AGTTGAGGGGACTTTCCCAGGC; PAX5, GAATGGGGCACTGAGGCGTGACCACCG; Smad 3/4, TCGAGAGCCAGACAAAAAGCCAGACATTTAGCCAGACAC; ISRE, CAGTTTCACTTTCCC; ICSBP, TGAGGAAACGAAACCATGAGGAAACGAAACCA; RSRFC4, GGTCTATTTATAGCTT; VDR, AGCTTCAGGTCAAGGAGGTCAGAGAGCT.
Detection of protein/oligonucleotide complex was performed with an EMSA gel-shift kit (Pamonics, CA). Briefly, nuclear protein (5 µg) was incubated with 10 ng/µl of biotin-labeled oligonucleotide for 30 min at room temperature in 5x binding buffer and 100 ng of poly(dI-dC). The specificity of the DNA/protein binding was determined in competition reactions in which a 50-fold molar excess of unlabeled oligonucleotide was added to the binding reaction. Products of binding reactions were resolved by electrophoresis on a 6% polyacrylamide gel by using 0.5x TBE buffer following by electrobloting to a nylon membrane (Schleicher and Schuell, Keene, NH). After incubation in blocking buffer for 15 min at room temperature, the membrane was incubated with streptavidin-HRP conjugate for 30 min at room temperature. The membrane was washed and visualized with SuperSignal chemiluminescence reagent (Pierce).
Immunoblot and immunofluorescence analysis.
Cells were exposed to TS for various time points, washed three times with chilled PBS containing 1 mM Na3VO4, and then lysed in an MAPK lysis buffer, and the protein concentrations were determined by the method of Lowry using the Bio-Rad DC assay (Bio-Rad, Hercules, CA). Equal protein amounts (40 µg) were resolved by 12% discontinous SDS-PAGE and blotted onto polyvinylidene difluoride membranes. After being blocked with 5% nonfat milk in TBS-Tween at room temperature for 1 h, the membranes were incubated with a polyclonal antibody against NF-
B (Santa Cruz Biotechnology). Membranes were washed three times with TBS-Tween before being probed with HRP-conjugated secondary antibodies for 1 h at room temperature. Blots were then visualized with SuperSignal chemiluminescence reagent (Pierce). For internal normalization of protein loading, membranes were stripped and probed with anti-GAPDH antibodies.
For immunofluorescence analysis, A549 cells were seeded and cultured on coverslips in a T25 flask. Cells, serum-starved overnight, were either directly exposed to 5 ml of freshly generated smoke for 30 min or pretreated with 10 µM U0126 and 20 µM PD98059 for 2 h and then exposed to 5 ml of freshly generated smoke for 30 min. Cells were washed with PBS, fixed with –20°C methanol for 10 min, washed in PBS (3 x 5 min), and blocked with 10% normal goat serum-1% BSA in PBS for 1 h at room temperature. After one wash with PBS, cells were incubated with primary antibody to the p65 or p50 subunit of NF-
B (Santa Cruz) overnight at 4°C. The coverslips were then washed and incubated with fluorescently labeled secondary antibody diluted in blocking solution for 45 min at room temperature. The nuclei were stained with DAPI. The coverslips were washed, mounted, and observed under the microscope. Cellular response to TS exposure was very similar to all treated/exposed cells in at least 15 fields examined that included at least 50 cells per field.
NF-
B binding ELISA.
Activation of NF-
B p50- or p65-dependent DNA binding activity was quantified with an ELISA-based detection method as described previously (14). Briefly, nuclear protein extraction from cells without or with treatments were applied to wells of streptavidin-coated 96-well plates containing an immobilized duplex of biotinylated-consensus sequences (2 pmol of probe/well) for NF-
B (AGTTGAGGGGACTTTCCCAGGC) and its mutant form (AGTTGAGGCCACTT-TCCCAGGC) and incubated for an hour with mild agitation. The captured active NF-
B bound to the biotinylated-consensus sequence was then incubated with specific primary antibody (p50 or p65) and followed with a secondary HRP-conjugated antibody. All microwells between experimental steps were washed four times with 200 µl PBS + 0.1% Tween-20. Ultra-3,3',5,5'-tetramethylbenzadine (TMB) substrate (100 µl; Pierce Biotechnology) was then added to the wells for 15 min at room temperature before 50 µl of 2N H2SO4 stopping solution was added. Optical density was then read at 450 nm, via a Packard microplate reader (Perkin-Elmer, Waltham, MA). The results were expressed after subtraction of the blank values. The blanks were realized following the same procedure as the samples, except that lysis buffer was incubated in the microwells instead of cell lysate. The specificity of NF-
B DNA binding was confirmed by competitions with wild-type and mutant
B binding sequences.
Plasmids and luciferase reporter assays.
Dominant negative ERK 1 (Lys71
Arg) and ERK 2 (Lys52
Arg) mutants each cloned in pCEP4 vector were generously provided by Dr. Melanie Cobb and had been characterized previously (15). NF-
B-pGL3 luciferase construct was a kind gift from Dr. Takashi Fujita (University of Tokyo, Japan). DNA transfections were performed by use of FuGENE 6 reagent according to the manufacturer's protocol (Roche Biochemical, Indianapolis, IN). Cells were transfected with 100 ng of promoter luciferase constructs. After 36-h expression, the cells were directly exposed to 3 ml per T12.5 flask of freshly generated smoke for 4 h. Cells were then washed with PBS and cell lyses were collected for luciferase activity measurement using a steady-glow luciferase reagent (Promega, Madison, WI). Luciferase activity of individual samples was normalized to that of
-galactosidase as described previously. All assay samples were performed in triplicate, and each experiment was repeated at least three times.
Stably transfected dominant negative cell lines. Dominant negative (dn) ERK mutant cell lines (dnERK 1-A549, dnERK 2-A549, and control expression vectors pCEPT4-A549) were established by selecting stably transfected (with dnERK 1, dnERK 2, and pCEPT4 expression constructs) in A549 cells using hygromycin. Cells lines were first identified by the overexpression of 6x histidine-tagged proteins, representative clones for dn-ERK 1-A549 and dnERK 2-A549 were selected, and the functional properties of these cell lines were confirmed when phosphorylated ERK 1 or ERK 2 was significantly decreased in PMA-induced ERK 1/2 phosphorylation compared with pCEPT4-A549 cells (supplemental data).1
Statistical methods. Data are expressed as the means ± SE of at least three independent experiments. The statistical significance of the differences between groups was determined by Student's t-test. A P value of <0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
|
|
B, PAX5, and Smad 3/4) and two TS-suppressed TFs (ISRE and ICSBP) were selected for further confirmation by EMSA analysis. Parallel experiments in A549 cells were performed to determine whether EMSA experiments confirmed our protein/DNA array data. The binding activities of nuclear proteins GATA, NF-
B, PAX5, and Smad 3/4 to their corresponding consensus DNA sequences were significantly increased in cells treated with TS compared with nuclear protein isolated from untreated cells (Fig. 2, A–D). Similarly, the binding activities of ISRE and ICSBP to their corresponding consensus DNA sequences were significantly decreased after TS treatment compared with untreated controls (Fig. 2, E–F). Intensity of the shifted bands for each examined TF were significantly or completely reduced by their respective cold probes (lane 4 of each panel of Fig. 2), which confirmed TF specificity. Also, no shifted bands were detected in the probe-only lane for all experiments (lane 1 of each panel of Fig. 2). These results were consistent with the results obtained from the protein/DNA arrays and further validated that TS exposure altered the DNA binding activities of multiple TFs.
|
|
|
B is regulated by MAPK-mediated I
B phosphorylation.
Because NF-
B modulates the expression of several important proinflammatory cytokines, we focused our attention on the mechanisms of TS-induced NF-
B activation in A549 cells. This included a detailed analysis of TS-induced I
B phosphorylation and NF-
B nuclear translocation. As shown in Fig. 5, peak phosphorylation of I
B was observed 10 min after TS exposure and steadily decreased at later time points (Fig. 5A). Nuclear p65 protein, p65(NP), increased immediately following a 10-min TS exposure and steadily increased at subsequent time points. In comparison, there was no significant change seen in cytosolic p65 protein, p65(CP), expression during TS exposure. Nuclear translocation of p50 similarly increased after 10 min of TS exposure. However, p50 translocation was variable after the initial 10-min time point.
|
B binding activity in our initial array (Fig. 3), we further examined whether MAPK was involved in TS-induced I
B phosphorylation and nuclear translocation of NF-
B protein. As shown in Fig. 5B, pretreatment of A549 cells with the MEK1/ERK inhibitors U0126 or PD98059 had no effect on NF-
B signaling components in untreated cells. However, peak TS-induced I
B phosphorylation (10 min) was significantly suppressed after pretreatment with U0126 or PD98059 (Fig. 5B). Similarly, pretreatment of A549 cells with U0126 or PD98059 inhibited peak TS-induced nuclear translocation of p65/p50 (Fig. 5B). Pretreatment of A549 cells with U0126 or PD98059 did not have significant effects on basal I
B phosphorylation or nuclear translocation of p65/p50 in untreated cells (Fig. 5B), which excluded nonspecific toxic effects due to the inhibitors.
TS-induced nuclear translocation of p65 and p50 was further confirmed by immunofluorescent microscopy. The p65/50 was normally expressed in the cytoplasm of untreated cells. After TS exposure, intense nuclear staining of both p65 and p50 was observed, with a concomitant decrease in cytoplasmic staining of each protein (Fig. 6). These data strongly support the notion that TS induced nuclear translocation of NF-
B protein. The observed nuclear translocation of NF-
B (both p65 and p50) was inhibited when cells were pretreated with the MEK1/ERK inhibitors U0126 or PD98059 (Fig. 6). These data were consistent with our Western blot analyses (Fig. 5B).
|
B DNA binding activity is mediated through MAPK signaling pathways in A549 cells.
To further examine whether translocated NF-
B actually resulted in increased functional activity, we performed EMSA to detect changes in NF-
B DNA binding activity after TS exposure. When A549 cells were exposed to TS, NF-
B DNA binding activity was significantly enhanced (Fig. 7A). This activity was significantly suppressed when cells were treated with the MEK1/ERK inhibitors PD98059 or U0126 prior to smoke exposure (Fig. 7A). No effect on basal NF-
B DNA binding was observed with the chemical inhibitors. To exclude the possibility that these observations were due to nonspecific effects of the chemical inhibitors, we also employed a dominant-negative approach. Using cell lines that stably express dominant negative (dn) ERK 1 or ERK 2 (A549-dnERK 1 and A549-dnERK 2), we observed similar inhibition of NF-
B DNA binding activity after TS exposure compared with vector-alone transfected cells (A549-pCEPT4) (Fig. 7B). No effect on basal NF-
B DNA binding was observed with either the chemical inhibitors or the dominant-negative expression vectors. These results strongly suggested that ERK 1 and ERK 2 pathways regulate TS-induced NF-
B DNA binding activity.
|
B was specific for p65 and p50 subunits, we employed an ELISA-based binding activity assay. The specific DNA binding activity of NF-
B consensus sequences to both p65 and p50 increased after TS exposure (Fig. 8, A and B). TS-induced NF-
B DNA binding activity was greatly reduced when an excess of nonbiotinylated probe [5x (5 pmol) or 20x (20 pmol)] containing wild-type NF-
B consensus sequence was added to the incubated cell lysate. However, nonbiotinylated probe containing the mutated NF-
B consensus sequence did not affect basal NF-
B binding activity. TS-induced increases in p65 or p50 NF-
B binding activity was supressed when ERK 1/2 inhibitors were added to cells prior to TS exposure (Fig. 8, A and B).
|
B promoter-luciferase reporter constructs further supported our observations. A549 cells transiently transfected with pGL3-NF-
B plasmids resulted in a 20-fold increase in luciferase activity compared with cells transfected with the pGL3 empty basal vector. TS exposure enhanced luciferase activity of pGL3-NF-
B 35-fold higher than the pGL3 empty basal vector (Fig. 8C). This 1.7-fold increase in TS-induced NF-
B promoter activity paralleled the increase in nuclear translocation of NF-
B protein as shown by Western blots (Fig. 5). The ERK 1/2 inhibitors U0126 and PD98059 both abolished TS-induced NF-
B promoter activity. | DISCUSSION |
|---|
|
|
|---|
B, were regulated through the ERK 1/2 signaling pathway.
Through a variety of genomic approaches, scientists can now identify how alterations in a single TF will modulate global gene expression (9). Also, pioneering work with individual TFs such as AP-1 and NF-
B demonstrated that these TFs were modulated after treatment with cigarette smoke condensate (1, 5, 6, 16, 17). However, there are more than 1,000 TFs. We suggest that an approach that focuses on a few TFs at a time will probably provide limited understanding of how TF activation can lead to human disease. The protein/DNA array technology applied in this study allowed us to simultaneously detect 244 different TFs. Most of these TFs have been previously demonstrated to be important for regulating gene expression (8). Using this approach, we were able to identify a manageable number of TS-regulated TFs, including TFs important for tumorigenesis and cell cycle regulation. To the best of our knowledge, this is the first report to screen and identify multiple TS-regulated TFs simultaneously. Our results provided novel information that could lead to better understanding of TS-related disease development and treatment.
In addition to the type of TFs that are induced by TS, we were able to identify a common mechanism responsible for increased TF activation. TFs can be activated through transcriptional, translational, or posttranslational mechanisms (2). For these studies, we focused on protein phosphorylation, which is likely the most common mechanism underlying TF activation after environmental stimulation. Results from our laboratory and others showed that ERK 1/2 signaling pathways are activated upon TS treatment (6, 11, 21). To further understand whether the MAPK/ERK pathway was also involved in TS-induced TF activation, we combined protein/DNA arrays with EMSAs to confirm that TS-regulated TFs were mediated by MAPK signaling cascades.
U0126 and PD98059 are MAPK inhibitors, and their major activity is to block the MAPK phosphorylation process. On the basis of our results from Western-blot analyses and EMSAs, translocation of NF-
B was significantly inhibited after pretreating cells with U0126 or PD98059. Pretreatment of cells with inhibitors alone did not elicit significant effects on basal level expressions of I
B phosphorylation or p65/p50 activity (Fig. 5). This indicated that TS-induced translocation of NF-
B is a transient event dependent on ERK 1/2 activation. The distribution of NF-
B between the cytoplasm and the nucleus of quiescent cells is relatively balanced, suggesting that resting cells have minimal activation of the NF-
B pathway. Consistent with this notion, inhibitory effects on I
B phosphorylation and p65/p50 translocation in resting cells were not observed. However, inhibition of MAPK signaling pathways in TS-treated cells resulted in significant modulation of I
B phosphorylation, NF-
B nuclear translocation, and NF-
B DNA binding activity. Our results suggest that the MAPK signaling pathways are essential in mediating TS-induced NF-
B activation and subsequent inflammatory gene expression.
It was reported that celecoxib, a cyclooxygenase-2 inhibitor, inhibited cigarette smoke condensate-induced nuclear translocation of p65 while blocking the decrease of cytosolic p65 in human non-small cell lung carcinoma H1299 cells (16). However, we observed substantial translocation of both p65 and p50 into the nucleus upon TS exposure but no significant decrease in cytoplasmic protein expression. It may be due to the high abundance of p65 and p50 protein in quiescent A549 cells, with only a small portion of protein translocated into the nucleus after TS treatment.
Of potential importance, VDR was activated upon TS exposure. VDR has previously been associated with decreased serum levels of the active form of vitamin D and an increased risk for certain cancers (7, 20). In comparison, two interferon-related TFs, ICSBP and ISRE, were shown to decrease their DNA binding activities after TS exposure. On the basis of these findings, the roles of ICSBP and ISRE in TS-induced airway inflammation merit further investigation.
To further establish the biological relevance of our results, 1-kb promoter sequences proximal to the transcriptional initiation site of two TS-responsive genes were analyzed using a bioinformatic approach. On the basis of a literature search, we chose one gene that is reported to be increased by TS exposure in airway epithelium (IL-8) and one gene that is suppressed by TS exposure (eotaxin) (10, 13). The results from our bioinformatics approach were combined with our array results (Table 1) to develop a schematic representation of the predicted TS-regulated TF binding sites present on IL-8 and eotaxin (Fig. 9). A twofold excess of potential TS-regulated TF binding sites were present on the proximal 1-kb promoter of the TS-inducible gene IL-8 compared with the TS-suppressed gene eotaxin. In addition, the proximal 1-kb promoter of eotaxin contains two putative TF binding sites for ICSBP. This TF was suppressed by TS in our studies. These data support our proposition that the array approach provides an efficient means of obtaining a global understanding of TS-induced gene regulation.
|
B activation mechanism via ERK 1/ERK 2 MAPK signaling pathways. We also provided an example of how our array data potentially will provide a broader understanding of how multiple genes, such as IL-8 and eotaxin, are differentially regulated by the same stimulus. We suggest that similar studies will be essential to better understand the complex biological signaling networks that occur in response to a particular exposure or treatment. | GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supplemental data for this article is available online at the American Journal of Physiology Lung Cellular and Molecular Physiology website. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Churg, M. Cosio, and J. L. Wright Mechanisms of cigarette smoke-induced COPD: insights from animal models Am J Physiol Lung Cell Mol Physiol, April 1, 2008; 294(4): L612 - L631. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |