AJP - Lung AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 293: L630-L638, 2007. First published June 15, 2007; doi:10.1152/ajplung.00110.2006
1040-0605/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/3/L630    most recent
00110.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laudi, S.
Right arrow Articles by Steudel, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laudi, S.
Right arrow Articles by Steudel, W.

Serotonin transporter protein in pulmonary hypertensive rats treated with atorvastatin

Sven Laudi,1,5 Saskia Trump,1 Volker Schmitz,1 James West,2 Ivan F. McMurtry,3 Haitham Mutlak,1 Uwe Christians,1 Jörg Weimann,4 Udo Kaisers,5 and Wolfgang Steudel1,6

1Department of Anesthesiology, Clinical Research and Development, 2Center for Genetic Lung Disease, and 3Cardiovascular Research Laboratories, University of Colorado at Denver and Health Sciences Center, Denver, Colorado; 4Department of Anesthesiology, Vrije University Medical Center, Amsterdam, The Netherlands; 5Department of Anesthesiology and Intensive Care Medicine, University of Leipzig Medical Faculty, Leipzig, Germany; and 6Department of Anesthesia and Critical Care, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts

Submitted 23 March 2006 ; accepted in final form 5 June 2007


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HMG-CoA-reductase inhibitors (statins) influence lipid metabolism and have pleiotropic effects. Several statins reduce various forms of pulmonary hypertension (PH) in animal models. The relationship between atorvastatin and expression of serotonin transporter protein (5-HTT) remains unknown. This study focused on the effects of atorvastatin on the course of monocrotaline (MCT)-induced PH and its relation to 5-HTT expression. Male Sprague-Dawley rats were challenged with MCT with or without subsequent daily oral treatment with 0.1, 1, and 10 mg/kg of atorvastatin for 28 days. Over the 4-wk course, the progression of PH was followed by transthoracic echocardiography [pulmonary artery pressure was assessed by pulmonary artery flow acceleration time (PAAT), an estimate reciprocal to pulmonary artery pressure], and, at the end of the 4-wk course, invasive right ventricular pressure, right ventricular weight, quantitative morphology, and 5-HTT expression were measured. MCT caused significant PH as early as 7 days after injection. Atorvastatin treatment increased PAAT and reduced right ventricular pressure, right ventricular hypertrophy, and vascular remodeling over the 4-wk course. MCT challenge was associated with increased pulmonary vascular 5-HTT expression, and atorvastatin treatment reduced the 5-HTT expression. MCT-induced PH over the course of 4 wk can be easily followed by transthoracic echocardiography, and atorvastatin is effective in reducing the PH. Atorvastatin's effects are associated with a decrease of 5-HTT expression.

monocrotaline; HMG-CoA-reductase inhibitor, 5-HTT, 5-HT


MEDIAL HYPERTROPHY of pulmonary arteries is the most consistent pathological finding in pulmonary hypertension (PH) (34). There is evidence that the medial hypertrophy is due to smooth muscle proliferation (35). In many forms of human primary and secondary PH, the hyperplasia of pulmonary artery smooth muscle cells is attributed to the overexpression of the serotonin transporter (5-HTT) (37).

Serotonin (5-HT) mediates cell signaling by interacting with several subtypes of 5-HT receptors and by internalization through the 5-HTT (2, 17, 33, 39, 65). Mitogenic and hypertrophic responses of smooth muscle cells to 5-HT are believed to be due at least partly to the action of the 5-HTT (9, 29). Both mitogenesis and cell hyperplasia following 5-HT may cause the activation of small GTPases, in particular Rac, the generation of reactive oxygen species (ROS) via NADPH activation, and the activation of the kinases MEK and ERK, as well as the transcription factor GATA-4 further downstream (28, 56, 61). The central role of 5-HTT in PH was underlined by the observation that patients with idiopathic pulmonary artery hypertension had an increased expression of 5-HTT in association with a marked enhancement of proliferative growth in pulmonary artery smooth muscle cell populations in response to 5-HT (12), but to our knowledge, not in response to other growth factors. Experimental data in rats and mice support the hypothesis that altered expression of 5-HTT plays a role in the pathogenesis of PH (7, 16); mice overexpressing 5-HTT develop PH even in the absence of other stimuli (32).

HMG-CoA-reductase inhibitors (statins) exhibit potent antiproliferative and anti-inflammatory effects besides their cholesterol-lowering effects (31, 58). In recent years, changes of serotonergic pathways in the central nervous system have been observed as a consequence of statin administration (62) and were linked to the expression and activity of the 5-HTT (47, 52). Therefore, it seems quite possible that statins have similar effects on cell populations such as pulmonary artery smooth muscle cells. In different models of PH, the salutary effects of statin treatment were shown, but it was generally linked to alterations in the nitric oxide pathways. For example, in a rat model of PH induced by the combination of monocrotaline (MCT) administration and unilateral pneumectomy, simvastatin attenuated the severity of PH (44, 45). More recently, similar results were reported in hypoxic PH (14). In three independent animal studies using hypoxia to induce PH, the beneficial effects of statins have been related to effects on nitric oxide-mediated pathways. Laufs et al. (27) described inhibition of eNOS downregulation by statins, Nishimura et al. (44) reported increased eNOS expression, and Murata et al. (42) linked the beneficial effects of statins to protection through eNOS activity at a posttranscriptional level. Whereas these studies suggested that increased NO synthase expression and/or activity were beneficial, Girgis et al. (14) reported unchanged eNOS expression during simvastatin treatment. These authors concluded that the prevention of posttranslational lipid modification of small G proteins (e.g., Rac) by statins might have been more important for their findings.

More recently, it was questioned if the effects of statins on PH are effects of all drugs of this pharmacological class, because there is evidence that different statins act differently in PH (48). It was reported by Rakotoniaina et al. (48) that atorvastatin in contrast to pravastatin could not prevent MCT-induced PH, although both equally increased the expression of eNOS.

To our knowledge, the effects of atorvastatin on the expression of 5-HTT have not been studied before. We used atorvastatin since it seems to have the most profound effects on vascular remodeling and smooth muscle proliferation (4, 5, 46). We first studied the effects of atorvastatin on MCT-induced PH in rats and subsequently investigated its influences on the expression of 5-HTT in pulmonary artery smooth muscle cells.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and Treatment

Experiments were performed in male Sprague-Dawley rats (age, 8–10 wk; body wt, 280–320 g). Animal protocols were approved by the University of Colorado at Denver and Health Sciences Center Committee on Animal Research, and animal care was conducted in accordance with the NIH guidelines for ethical animal research (Guide for the Care and Use of Laboratory Animals, National Institutes of Health publication No. 85-23, revised 1996). For the hemodynamic measurement procedures, rats were anesthetized with ketamine (40 mg/kg ip) and xylazine (5 mg/kg ip). On day 0, after baseline measurements, PH was induced using MCT (see below). Atorvastatin or vehicle control (skim milk or atorvastatin dissolved in skim milk) was administered by oral gavage daily from day 1 to day 28. On days 0, 7, 14, 21, and 28, transthoracic echocardiography was performed (see below). On day 28, invasive hemodynamic measurements were obtained, and after euthanasia with pentobarbital (100 mg/kg), lung as well as heart tissues were harvested.

Induction of Pulmonary Hypertension

PH was induced on day 0 by a single dose of MCT (60 mg/kg sc; Sigma-Aldrich, St. Louis, MO).

Dose-Dependent Effects of Atorvastatin

Rats were randomly assigned to eight treatment groups (n = 6 rats/group): 1) control (vehicle only); 2) atorvastatin, 0.10 mg·kg–1·day–1; 3) atorvastatin, 1.0 mg·kg–1·day–1 c; 4) atorvastatin, 10.0 mg·kg–1·day–1; 5) MCT + vehicle; 6) MCT + atorvastatin, 0.10 mg·kg–1·day–1; 7) MCT + atorvastatin, 1.0 mg·kg–1·day–1; and 8) MCT + atorvastatin, 10.0 mg·kg–1·day–1. PH was evaluated by echocardiographically determined pulmonary artery acceleration time (PAAT), by invasive measurement of right ventricular systolic pressure (RVSP) on day 28, and by assessment of the degree of vascular muscularization on day 28.

Effects of Atorvastatin on 5-HTT

Right ventricular heart weight in relation to left ventricular and septal weight [RV/(LV+S)] and expression of 5-HTT were only determined for the most effective dose of atorvastatin.

Echocardiographic Measurements

Transthoracic echocardiography was performed using a 10-MHz ultrasound probe with a Vivid FiVe System (General Electrics Vingmed Ultrasound, Horton, Norway). Echocardiographic data were analyzed with EchoPac 6.3.6 software (General Electrics Vingmed Ultrasound). Ejection fraction, shortening fraction, left ventricular end-diastolic diameter, cardiac output, and PAAT were obtained as previously described (21, 49, 57, 64). A decreased PAAT corresponds to an increased pulmonary artery pressure or RVSP (21, 49, 57, 64).

All echocardiographic measurements were performed in triplicate by one investigator and averaged.

Invasive Hemodynamic Measurements

To measure RVSP, a microtip transducer (1.4 Fr; Millar Instruments, Houston, TX) was inserted into the right jugular vein and advanced into the right ventricle. Systolic and diastolic pressures were recorded at closed chest and analyzed using Hemodyn v1.1 software (Hugo Sachs Electronics, March-Hugstetten, Germany).

Lung and Heart Tissue

After measurement of RVSP, the chest was opened and the left lung immediately removed and frozen in liquid nitrogen. The right lung was perfused with buffered formalin. The heart was then removed and dissected, and the free right ventricular wall, left ventricle, and septum were weighed.

Immunohistochemistry

Paraffin-embedded right lung tissue was cut into 5-µm-thick lung sections and subsequently immunostained with an antibody against {alpha}-smooth muscle actin ({alpha}-SMA) (A2547; Sigma-Aldrich) and 5-HTT (sc-1458; Santa Cruz Biotechnology, Santa Cruz, CA) as described elsewhere (22, 23, 60).

Western Blotting

Expression of 5-HTT in lung tissue was measured by Western blotting using an antibody against 5-HTT (Santa Cruz Biotechnology). After homogenization on ice in Tris·HCl buffer, lung tissue (30 µg of protein) was separated by SDS-PAGE and then transferred to nitrocellulose membranes. Immunodetection was performed with the primary antibody (dilution, 1:500) after incubation in blocking solution. The secondary antibody (donkey anti-goat IgG-HRP; Santa Cruz Biotechnology; dilution, 1:3,000) was then applied after washing, and thereafter, ECL Plus detection (Amersham, Piscataway, NJ) was performed.

RT-PCR

Primers were designed using GenBank sequences and the PerkinElmer ABI Primer Express program: sequence 5' to 3', GTCAGAGGTGGCCAAAGACG 1182 F (forward); and sequence 5' to 3', TGGCAAAGAACGTGGATGC 1273 R (reverse). Each primer (all are species specific) was searched against Basic Local Alignment Search Tool to ensure that it did not match any known gene, aside from that for which it was designed. The primers were designed specifically for quantitative RT-PCR to produce products of comparable size. RNA was made using a Qiagen RNeasy mini kit (Qiagen, Valencia, CA). cDNA was made using Superscript II RT with oligo(dT)12–18 primers (both from Invitrogen, Carlsbad, CA) from this RNA. For screening gels, PCR was carried out in a GeneAmp Sequence Detection System 5700 (Perkin Elmer, Norwalk, CT) using 40 cycles of 95–60°C PCR with a 10-min 95°C initial soak. For quantitative PCR, the same equipment was used, but the fluorescent indicator Sybrgreen was intercalated to allow real-time light detection. Each sample was tested individually for the housekeeping gene hypoxanthine guanine phosphoribosyl transferase (HPRT) and 5-HTT. Linear increases in fluorescence were confirmed, and the cycle number at detection was expressed relative to that for detection of HPRT. Each measurement was made in triplicate and averaged, with three individual replicate experiments used for statistical analysis (66).

Degree of Muscularization

The degree of pulmonary vascular muscularization was measured as previously reported (22). Wall structure, external diameter (ED), and size of 50 alveolar vessels per animal were determined and recorded, and the wall thickness and ED of muscular and partially muscular vessels were measured. Percent wall thickness (%WT) was calculated as (2 x 100 x WT)/ED.

Statistical Analysis

All data are shown as means ± SD unless otherwise indicated. Differences between groups were analyzed using one-way ANOVA. Post hoc analysis was performed using the Sidak method (51). Differences in groups were compared using paired t-tests. A P value <0.05 was considered significant. Statistical calculations were performed using SPSS 14.0 software (SPSS, Chicago, IL).


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Echocardiographic-Determined PAAT

PAAT did not change in control animals over the course of 28 days.

MCT exposure only. PAAT decreased from 27.5 ± 3.1 ms to 20.4 ± 4.3 ms on day 7 (P = 0.005) and to 15.3 ± 1.6 ms on day 28 (P < 0.001) in MCT-challenged rats, consistent with PH.

Atorvastatin, 0.1 mg·kg–1·day–1. PAAT was not different over the 28-day time course in rats that were treated with 0.1 mg·kg–1·day–1 atorvastatin after the initial MCT challenge compared with rats that were only exposed to MCT (data not shown).

Atorvastatin, 1 and 10 mg·kg–1·day–1. Rats treated with daily doses of 1 and 10 mg/kg atorvastatin had a significantly lower PAAT at day 14 compared with baseline (23.7 ± 4.1 ms vs. 30.0 ± 4.4 ms and 24.5 ± 5.0 vs. 30.5 ± 2.9 ms, P = 0.005 and P = 0.013, respectively), but PAAT was still above the values of rats that did not receive atorvastatin after MCT challenge (18.6 ± 3.3 ms, P = 0.006).

On day 28, PAAT in MCT-exposed rats that received daily doses of 10 mg·kg–1 atorvastatin (20.6 ± 4.4 ms) was above the values obtained from MCT-challenged rats (15.3 ± 2.2 ms, P < 0.001) but significantly lower in comparison with control rats that also received 10 mg·kg–1·day–1 atorvastatin (P < 0.001, Fig. 1) .


Figure 1
View larger version (33K):
[in this window]
[in a new window]

 
Fig. 1. Pulmonary artery acceleration time (PAAT); typical pulmonary artery flow on day 28 for control (A), MCT (B), and (C) MCT atorvastatin 10 mg·kg–1·day–1. D: change of PAAT from day 0 (induction of PH) to day 28 (means ± SE); diamonds, untreated controls; circles, MCT; squares, MCT-AT 1 mg·kg–1·day–1; triangles, MCT-AT 10 mg·kg–1·day–1, *P = 0.005 vs. baseline; #P < 0.01 vs. baseline (day 0, same group) and vs. MCT (same day) (n = 6 rats per group).

 
Summary of echocardiographic findings. The most important echocardiographic finding was that atorvastatin influences PAAT (and therefore, the degree of PH) over the 28-day course of treatment. Fourteen days of daily doses of 1 and 10 mg atorvastatin caused a clear PAAT increase (and reciprocally, a decrease of estimated pulmonary artery pressure). After 21 days of treatment with atorvastatin, there may be a continuing trend, but this could not be statistically confirmed. After 28 days of daily atorvastatin treatment with 10 mg·kg–1 but not 1 mg·kg–1, the benefit was again visible and statistically supported.

RVSP

RVSP was obtained invasively at the end of the 28-day treatment course, and control rats that did not receive MCT but different doses of atorvastatin (0, 0.1, 1, and 10 mg·kg–1·day–1, respectively) had equal effects on RVSP (Fig. 2A). Rats challenged with MCT had a significantly increased RVSP compared with their controls (P < 0.001). Treatment of MCT rats with atorvastatin showed a significant, dose-dependent decrease of RVSP compared with rats that did not receive atorvastatin (P < 0.001; Fig. 2B).


Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 2. Right ventricular systolic pressure (RVSP); CTR, control; MCT, monocrotaline; AT, atorvastatin; #: P < 0.05; *: P < 0.001; (n = 6 rats per group).

 
Pulmonary Vascular Morphology

Pulmonary arterioles and small pulmonary arteries of control animals showed only slight staining with {alpha}-SMA. {alpha}-SMA presence was not affected by different atorvastatin doses in control rats without PH. Percent wall thickness of fully muscularized vessels ranged between 21 ± 5% and 24 ± 6% (not significant). Percent wall thickness increased to 41 ± 6% (P < 0.001) with MCT. Atorvastatin treatment decreased percent wall thickness in a dose-dependent fashion compared with rats that were challenged with MCT but did not receive atorvastatin (Table 1, Fig. 3). Daily doses of 10 mg·kg–1 atorvastatin after MCT challenge reduced the percent wall thickness from 41 ± 6% (MCT) to 28 ± 6% (MCT and 10 mg·kg–1·day–1 atorvastatin, P = 0.038).


View this table:
[in this window]
[in a new window]

 
Table 1. Percent wall thickness of vessels

 

Figure 3
View larger version (70K):
[in this window]
[in a new window]

 
Fig. 3. Representative smooth muscle {alpha}-actin staining (red); control (A); monocrotaline (B); monocrotaline + atorvastatin 0.1 mg·kg–1·day–1 (C); monocrotaline + atorvastatin 1.0 mg·kg–1·day–1 (D); and monocrotaline + atorvastatin 10.0 mg·kg–1·day–1 (E). Bars equal 20 µm.

 
Based on the echocardiographic, hemodynamic, and morphological data, we assumed that the daily atorvastatin administration of 10 mg·kg–1 was most effective and proceeded using this dose for the subsequent experiments.

RV/(LV+S)

No differences of RV/(LV+S) were observed between control rats and control rats treated with 10 mg·kg–1·day–1 atorvastatin. In MCT-challenged rats (not receiving atorvastatin treatment), RV/(LV+S) was 0.57 ± 0.11 compared with animals that were not challenged (0.35 ± 0.08; P < 0.001). MCT-exposed rats that were treated with daily doses of 10 mg·kg–1 atorvastatin for 28 days had a significantly lower RV/(LV+S) than animals challenged with MCT alone (0.41 ± 0.90 vs. 0.57 ± 0.11; P< 0.001, Fig. 4).


Figure 4
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 4. Right heart weight in relation to left ventricular and septal weight [RV/(LV+S)]; CTR, control; MCT, monocrotaline; AT, atorvastatin; *: P < 0.001.

 
PCR

In whole lung tissue homogenates, 28 days after MCT challenge, no significant differences between groups were seen for mRNA levels of 5-HTT (Fig. 5).


Figure 5
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 5. Expression of the serotonin transporter mRNA; relative quantities on four lungs.

 
Western Blotting

In whole lung tissue homogenates, 28 days after MCT challenge, expression of 5-HTT increased. In contrast, treatment with atorvastatin decreased the expression of 5-HTT independent of whether the animals received MCT (Fig. 6).


Figure 6
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 6. Expression of the serotonin transporter protein (5-HTT); representative Western blots of 5-HTT and beta-actin; relative densitometry on five lungs; *P = 0.025

 
Immunohistochemistry

Some 5-HTT staining, mostly in subendothelial layers, was seen in pulmonary vascular smooth muscle cells of control animal lungs. MCT caused a distinct increase in 5-HTT staining in the medial and adventitial layer. This 5-HTT staining was almost totally prevented by atorvastatin treatment (Fig. 7).


Figure 7
View larger version (58K):
[in this window]
[in a new window]

 
Fig. 7. Serotonin transporter (5-HTT; dark brown) stained lung sections; A: control, small amounts of 5-HTT in the subendothelium; B: MCT cause an increased staining of 5-HTT primarily in the medial/adventitial margin; C: the combination of MCT and atorvastatin (10.0 mg·kg–1·day–1) decreased 5-HTT staining in the medial/adventitial margin.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We examined the effects of atorvastatin on MCT-induced PH and, in particular, on the expression of 5-HTT. We found a dose-dependent reduction of PH, which was paralleled by a clear reduction of 5-HTT protein in pulmonary arterial smooth muscle cells. The effects of MCT on the pulmonary artery pressure over time were followed using a noninvasive method, transthoracic echocardiography. As soon as 7 days after induction of PH, we observed that atorvastatin (1.0 mg·kg–1·day–1) reduced the progression of PH, and that at a dose of 10.0 mg·kg–1·day–1 atorvastatin attenuated PH over the course of 28 days. PAAT (an echocardiographic estimate of pulmonary artery pressure) increased, and invasively measured RVSP and right ventricular hypertrophy were significantly reduced by atorvastatin treatment in MCT-challenged rats.

MCT has to be bioactivated in liver cytochrome P-450s (CYP) to MCT pyrrole, which is responsible for the MCT-induced pulmonary hypertension (24). Since atorvastatin is a CYP substrate as well, there might be a possibility that the shown effects are related to impairment of MCT metabolism. In humans, atorvastatin is solely metabolized by cytochrome P-450 (CYP) 3A4 and is, therefore, a strong inhibitor of CYP3A4 (30). In contrast to humans, rats do not have CYP3A4 (8, 38). While in female Sprague-Dawley rats statins are metabolized by CYP3A2, it seems that in male Sprague-Dawley rats statins are predominantly metabolized by CYP2C11 (18–20). Since MCT is activated to MCT pyrrole (MCTP) by CYP3A isozymes, but not CYP2C11 (24, 50), it is unlikely that the effects of atorvastatin on MCT-induced PH are inhibitory effects of atorvastatin on the activation of MCT. This is further supported by the fact that the half-life of MCT in rats is rather short, and only small quantities of MCTP are necessary for its pulmonary toxicity (13). After subcutaneous injection, all MCT is activated and, including its metabolites, cleared from the body within 24 h (40, 41, 54). Since we allowed 24 h between the MCT challenge and the beginning of the atorvastatin treatment, probably all of the initially injected MCT was already metabolized or excreted before the atorvastatin treatment was begun.

Using chronic hypoxia as the stimulus to induce PH, Girgis et al. (14) reported that simvastatin (20 mg·kg–1·day–1 ip) reduced PH in rats. In a rat model combining left pneumonectomy and MCT challenge to induce severe PH, Nishimura and colleagues (44) observed that orally administered simvastatin (2 mg·kg–1·day–1 po) clearly attenuated PH. Fluvastatin also reduced hypoxia-induced PH at a dose of 1 mg·kg–1·day–1 po (42). Our results were overall in agreement with these studies (14, 42, 44), which used different approaches to induce PH and different statins; however, the authors mainly addressed endothelial effects of statins, such as eNOS expression and activity.

In a study comparing the effects of pravastatin and atorvastatin on MCT-induced PH, both statins showed the same effects on the expression of eNOS, but treatment with atorvastatin had, in contrast to pravastatin and in contrast to our results, no significant effect on lowering RVSP (48). Therefore, mechanisms other than regulation of eNOS expression have to be involved in the statin's effect on PH.

We are not aware that a relationship between statin's effects on the serotonin pathway, especially the serotonin transporter protein, has been studied in the pulmonary circulation.

We observed that MCT-induced PH increased the expression of 5-HTT in smooth muscle cells of the pulmonary arterial circulation. These effects were reversed by using atorvastatin at a dose of 10 mg·kg–1·day–1.

It appears that 4-wk treatment with atorvastatin decreased expression of 5-HTT even in the absence of PH, but the reduction was more prominent in PH.

Even if we could not directly show how atorvastatin decreased the expression of 5-HTT, it is clear from the mRNA data that it seems to be a posttranslational process, since mRNA levels were the same in all groups. It is known that statins disrupt the N-glycosylation of membrane-targeted proteins (53, 55). The N-glycosylation of 5-HTT does not alter its activity but seems to protect 5-HTT from degradation (3). Therefore, one might speculate that atorvastatin prevented the N-glycosylation of 5-HTT, leading to a higher turnover. The high turnover might have resulted in a net decrease of 5-HTT protein amount (26).

There is some evidence that 5-HTT expression is increased in MCT-induced PH. Guignabert et al. (16) showed an early and sustained increase of 5-HTT mRNA and protein levels after MCT challenge. In chronic hypoxia, the correlation between 5-HTT and PH is less clear. While Eddahibi et al. (9, 10) reported increased 5-HTT transcription and expression in smooth muscle cells of the pulmonary circulation, other studies describe decreased expression of 5-HTT (32, 39, 63). Congenital absence of 5-HTT renders mice less prone to hypoxia-induced PH (10), whereas an increased expression of 5-HTT is a common observation in various forms of human PH (11, 12, 37).

Additional evidence for an important role of 5-HTT in PH has been derived from data showing that selective inhibition of 5-HTT prevents PH. 5-HTT inhibition using citalopram or fluoxetine attenuated PH in chronically hypoxic mice (36). Fluoxetine also prevented the development of PH in MCT-challenged rats (16). In general, there seems to be agreement that a higher expression of 5-HTT is associated with a higher pulmonary artery pressure, and the inhibition of this pathway reduces PH.

An additional possible mechanism for the beneficial effects of atorvastatin on PH might be the inhibition of the RhoA/ROCK pathway. It has been observed that Rho-kinase-mediated pathways play a central role in the pathogenesis of PH (1). The inhibition of the Rho-kinase by fasudil improved the PH substantially (1, 43). Statins inhibit the Rho-kinase pathway (6, 15, 25), which raises the possibility that the effects of atorvastatin might have been at least partly due to inhibition of RhoA and/or Rac1.

One limitation of our study is that we did not distinguish between the role of vasoconstriction or remodeling in PH. Stenmark and McMurtry (59) recently emphasized the importance of relaxation of pulmonary vessels prior to evaluation of their luminal obstruction by neomuscularization. They suggested the administration of a Rho-kinase inhibitor before permanent fixation of the lung to allow maximal relaxation of the vasculature.

In summary, we conclude that atorvastatin prevents MCT-induced PH. Atorvastatin treatment in pulmonary hypertension is associated with the downregulation of HTT expression in pulmonary vascular smooth muscle cells, reduced pulmonary artery pressure, reduced vascular remodeling, and reduced right ventricular hypertrophy. Further details of the exact molecular mechanism need to be addressed in future studies.


    ACKNOWLEDGMENTS
 
The work presented has been supported by a Foundation of Anesthesia Education and Research Grant (W. Steudel), National Heart, Lung, and Blood Institute Grant R01-HL-071805-02 (W. Steudel and U. Christians), and a National Institute of Diabetes and Digestive and Kidney Diseases grant P30-EK-048520-10 (U. Christians).


    FOOTNOTES
 

Address for reprint requests and other correspondence: Wolfgang Steudel, Dept. of Anesthesia and Critical Care, 55 Fruit Street, Gray/Jackson 4, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114 (e-mail: wsteudel{at}partners.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Abe K, Shimokawa H, Morikawa K, Uwatoku T, Oi K, Matsumoto Y, Hattori T, Nakashima Y, Kaibuchi K, Sueishi K, Takeshit A. Long-term treatment with a Rho-kinase inhibitor improves monocrotaline-induced fatal pulmonary hypertension in rats. Circ Res 94: 385–393, 2004.[Abstract/Free Full Text]
  2. Azmitia EC. Modern views on an ancient chemical: serotonin effects on cell proliferation, maturation, and apoptosis. Brain Res Bull 56: 413–424, 2001.[CrossRef][Web of Science][Medline]
  3. Blakely RD, De Felice LJ, Hartzell HC. Molecular physiology of norepinephrine and serotonin transporters. J Exp Biol 196: 263–281, 1994.[Abstract/Free Full Text]
  4. Bonetti PO, Lerman LO, Napoli C, Lerman A. Statin effects beyond lipid lowering–are they clinically relevant? Eur Heart J 24: 225–248, 2003.[Free Full Text]
  5. Cannon CP, Braunwald E, McCabe CH, Rader DJ, Rouleau JL, Belder R, Joyal SV, Hill KA, Pfeffer MA, Skene AM. Intensive versus moderate lipid lowering with statins after acute coronary syndromes. N Engl J Med 350: 1495–1504, 2004.[Abstract/Free Full Text]
  6. Casey PJ. Protein lipidation in cell signaling. Science 268: 221–225, 1995.[Abstract/Free Full Text]
  7. de Caestecker M. Serotonin signaling in pulmonary hypertension. Circ Res 98: 1229–1231, 2006.[Free Full Text]
  8. Eagling VA, Tjia JF, Back DJ. Differential selectivity of cytochrome P450 inhibitors against probe substrates in human and rat liver microsomes. Br J Clin Pharmacol 45: 107–114, 1998.[CrossRef][Web of Science][Medline]
  9. Eddahibi S, Fabre V, Boni C, Martres MP, Raffestin B, Hamon M, Adnot S. Induction of serotonin transporter by hypoxia in pulmonary vascular smooth muscle cells. Relationship with the mitogenic action of serotonin. Circ Res 84: 329–336, 1999.[Abstract/Free Full Text]
  10. Eddahibi S, Hanoun N, Lanfumey L, Lesch KP, Raffestin B, Hamon M, Adnot S. Attenuated hypoxic pulmonary hypertension in mice lacking the 5-hydroxytryptamine transporter gene. J Clin Invest 105: 1555–1562, 2000.[Web of Science][Medline]
  11. Eddahibi S, Humbert M, Fadel E, Raffestin B, Darmon M, Capron F, Simonneau G, Dartevelle P, Hamon M, Adnot S. Hyperplasia of pulmonary artery smooth muscle cells is causally related to overexpression of the serotonin transporter in primary pulmonary hypertension. Chest 121: 97S–98S, 2002.[CrossRef]
  12. Eddahibi S, Humbert M, Fadel E, Raffestin B, Darmon M, Capron F, Simonneau G, Dartevelle P, Hamon M, Adnot S. Serotonin transporter overexpression is responsible for pulmonary artery smooth muscle hyperplasia in primary pulmonary hypertension. J Clin Invest 108: 1141–1150, 2001.[CrossRef][Web of Science][Medline]
  13. Estep JE, Lame MW, Morin D, Jones AD, Wilson DW, Segall HJ. [14C]monocrotaline kinetics and metabolism in the rat. Drug Metab Dispos 19: 135–139, 1991.[Abstract]
  14. Girgis RE, Li D, Zhan X, Garcia JG, Tuder RM, Hassoun PM, Johns RA. Attenuation of chronic hypoxic pulmonary hypertension by simvastatin. Am J Physiol Heart Circ Physiol 285: H938–H945, 2003.[Abstract/Free Full Text]
  15. Goldstein JL, Brown MS. Regulation of the mevalonate pathway. Nature 343: 425–430, 1990.[CrossRef][Medline]
  16. Guignabert C, Raffestin B, Benferhat R, Raoul W, Zadigue P, Rideau D, Hamon M, Adnot S, Eddahibi S. Serotonin transporter inhibition prevents and reverses monocrotaline-induced pulmonary hypertension in rats. Circulation 111: 2812–2819, 2005.[Abstract/Free Full Text]
  17. Inoue T, Kusumi I, Yoshioka M. Serotonin transporters. Curr Drug Targets CNS Neurol Disord 1: 519–529, 2002.[CrossRef][Medline]
  18. Ishigami M, Honda T, Takasaki W, Ikeda T, Komai T, Ito K, Sugiyama Y. A comparison of the effects of 3-hydroxy-3-methylglutaryl-coenzyme a (HMG-CoA) reductase inhibitors on the CYP3A4-dependent oxidation of mexazolam in vitro. Drug Metab Dispos 29: 282–288, 2001.[Abstract/Free Full Text]
  19. Ishigami M, Kawabata K, Takasaki W, Ikeda T, Komai T, Ito K, Sugiyama Y. Drug interaction between simvastatin and itraconazole in male and female rats. Drug Metab Dispos 29: 1068–1072, 2001.[Abstract/Free Full Text]
  20. Ishigami M, Takasaki W, Ikeda T, Komai T, Ito K, Sugiyama Y. Sex difference in inhibition of in vitro mexazolam metabolism by various 3-hydroxy-3-methylglutaryl-coenzyme a reductase inhibitors in rat liver microsomes. Drug Metab Dispos 30: 904–910, 2002.[Abstract/Free Full Text]
  21. Jones JE, Mendes L, Rudd MA, Russo G, Loscalzo J, Zhang YY. Serial noninvasive assessment of progressive pulmonary hypertension in a rat model. Am J Physiol Heart Circ Physiol 283: H364–H371, 2002.[Abstract/Free Full Text]
  22. Jones R, Jacobson M, Steudel W. alpha-smooth-muscle actin and microvascular precursor smooth-muscle cells in pulmonary hypertension. Am J Respir Cell Mol Biol 20: 582–594, 1999.[Abstract/Free Full Text]
  23. Jones R, Steudel W, White S, Jacobson M, Low R. Microvessel precursor smooth muscle cells express head-inserted smooth muscle myosin heavy chain (SM-B) isoform in hyperoxic pulmonary hypertension. Cell Tissue Res 295: 453–465, 1999.[CrossRef][Web of Science][Medline]
  24. Kasahara Y, Kiyatake K, Tatsumi K, Sugito K, Kakusaka I, Yamagata S, Ohmori S, Kitada M, Kuriyama T. Bioactivation of monocrotaline by P-450 3A in rat liver. J Cardiovasc Pharmacol 30: 124–129, 1997.[CrossRef][Web of Science][Medline]
  25. Kato T, Hashikabe H, Iwata C, Akimoto K, Hattori Y. Statin blocks Rho/Rho-kinase signalling and disrupts the actin cytoskeleton: relationship to enhancement of LPS-mediated nitric oxide synthesis in vascular smooth muscle cells. Biochim Biophys Acta 1689: 267–272, 2004.[Medline]
  26. Kimmel H, Vicentic A, Kuhar MJ. Neurotransmitter transporters synthesis and degradation rates. Life Sci 68: 2181–2185, 2001.[CrossRef][Web of Science][Medline]
  27. Laufs U, Fata VL, Liao JK. Inhibition of 3-hydroxy-3-methylglutaryl (HMG)-CoA reductase blocks hypoxia-mediated down-regulation of endothelial nitric oxide synthase. J Biol Chem 272: 31725–31729, 1997.[Abstract/Free Full Text]
  28. Lee SL, Wang WW, Finlay GA, Fanburg BL. Serotonin stimulates mitogen-activated protein kinase activity through the formation of superoxide anion. Am J Physiol Lung Cell Mol Physiol 277: L282–L291, 1999.[Abstract/Free Full Text]
  29. Lee SL, Wang WW, Lanzillo JJ, Fanburg BL. Serotonin produces both hyperplasia and hypertrophy of bovine pulmonary artery smooth muscle cells in culture. Am J Physiol Lung Cell Mol Physiol 266: L46–L52, 1994.[Abstract/Free Full Text]
  30. Lennernas H. Clinical pharmacokinetics of atorvastatin. Clin Pharmacokinet 42: 1141–1160, 2003.[CrossRef][Web of Science][Medline]
  31. Liao JK, Laufs U. Pleiotropic effects of statins. Annu Rev Pharmacol Toxicol 45: 89–118, 2005.[CrossRef][Web of Science][Medline]
  32. MacLean MR, Deuchar GA, Hicks MN, Morecroft I, Shen S, Sheward J, Colston J, Loughlin L, Nilsen M, Dempsie Y, Harmar A. Overexpression of the 5-hydroxytryptamine transporter gene: effect on pulmonary hemodynamics and hypoxia-induced pulmonary hypertension. Circulation 109: 2150–2155, 2004.[Abstract/Free Full Text]
  33. MacLean MR, Herve P, Eddahibi S, Adnot S. 5-hydroxytryptamine and the pulmonary circulation: receptors, transporters and relevance to pulmonary arterial hypertension. Br J Pharmacol 131: 161–168, 2000.[CrossRef][Web of Science][Medline]
  34. Mandegar M, Fung YC, Huang W, Remillard CV, Rubin LJ, Yuan JX. Cellular and molecular mechanisms of pulmonary vascular remodeling: role in the development of pulmonary hypertension. Microvasc Res 68: 75–103, 2004.[CrossRef][Web of Science][Medline]
  35. Mandegar M, Thistlethwaite PA, Yuan JX. Molecular biology of primary pulmonary hypertension. Cardiol Clin 22: 417–429, vi, 2004.[CrossRef][Web of Science][Medline]
  36. Marcos E, Adnot S, Pham MH, Nosjean A, Raffestin B, Hamon M, Eddahibi S. Serotonin transporter inhibitors protect against hypoxic pulmonary hypertension. Am J Respir Crit Care Med 168: 487–493, 2003.[Abstract/Free Full Text]
  37. Marcos E, Fadel E, Sanchez O, Humbert M, Dartevelle P, Simonneau G, Hamon M, Adnot S, Eddahibi S. Serotonin-induced smooth muscle hyperplasia in various forms of human pulmonary hypertension. Circ Res 94: 1263–1270, 2004.[Abstract/Free Full Text]
  38. Marumo H, Satoh K, Yamamoto A, Kaneta S, Ichihara K. Simvastatin and atorvastatin enhance hypotensive effect of diltiazem in rats. Yakugaku Zasshi 121: 761–764, 2001.[CrossRef][Web of Science][Medline]
  39. Morecroft I, Loughlin L, Nilsen M, Colston J, Dempsie Y, Sheward J, Harmar A, MacLean MR. Functional interactions between 5-hydroxytryptamine receptors and the serotonin transporter in pulmonary arteries. J Pharmacol Exp Ther 313: 539–548, 2005.[Abstract/Free Full Text]
  40. Mukhopadhyay S, Sehgal PB. Discordant regulatory changes in monocrotaline-induced megalocytosis of lung arterial endothelial and alveolar epithelial cells. Am J Physiol Lung Cell Mol Physiol 290: L1216–L1226, 2006.[Abstract/Free Full Text]
  41. Mukhopadhyay S, Shah M, Patel K, Sehgal PB. Monocrotaline pyrrole-induced megalocytosis of lung and breast epithelial cells: Disruption of plasma membrane and Golgi dynamics and an enhanced unfolded protein response. Toxicol Appl Pharmacol 211: 209–220, 2006.[CrossRef][Web of Science][Medline]
  42. Murata T, Kinoshita K, Hori M, Kuwahara M, Tsubone H, Karaki H, Ozaki H. Statin protects endothelial nitric oxide synthase activity in hypoxia-induced pulmonary hypertension. Arterioscler Thromb Vasc Biol 25: 2335–2342, 2005.[Abstract/Free Full Text]
  43. Nagaoka T, Fagan KA, Gebb SA, Morris KG, Suzuki T, Shimokawa H, McMurtry IF, Oka M. Inhaled Rho kinase inhibitors are potent and selective vasodilators in rat pulmonary hypertension. Am J Respir Crit Care Med 171: 494–499, 2005.[Abstract/Free Full Text]
  44. Nishimura T, Faul JL, Berry GJ, Vaszar LT, Qiu D, Pearl RG, Kao PN. Simvastatin attenuates smooth muscle neointimal proliferation and pulmonary hypertension in rats. Am J Respir Crit Care Med 166: 1403–1408, 2002.[Abstract/Free Full Text]
  45. Nishimura T, Vaszar LT, Faul JL, Zhao G, Berry GJ, Shi L, Qiu D, Benson G, Pearl RG, Kao PN. Simvastatin rescues rats from fatal pulmonary hypertension by inducing apoptosis of neointimal smooth muscle cells. Circulation 108: 1640–1645, 2003.[Abstract/Free Full Text]
  46. Nissen SE, Tuzcu EM, Schoenhagen P, Brown BG, Ganz P, Vogel RA, Crowe T, Howard G, Cooper CJ, Brodie B, Grines CL, DeMaria AN. Effect of intensive compared with moderate lipid-lowering therapy on progression of coronary atherosclerosis: a randomized controlled trial. JAMA 291: 1071–1080, 2004.[Abstract/Free Full Text]
  47. Papakostas GI, Petersen T, Mischoulon D, Hughes ME, Alpert JE, Nierenberg AA, Rosenbaum JF, Fava M. Serum cholesterol and serotonergic function in major depressive disorder. Psychiatry Res 118: 137–145, 2003.[CrossRef][Web of Science][Medline]
  48. Rakotoniaina Z, Guerard P, Lirussi F, Goirand F, Rochette L, Dumas M, Bardou M. The protective effect of HMG-CoA reductase inhibitors against monocrotaline-induced pulmonary hypertension in the rat might not be a class effect: comparison of pravastatin and atorvastatin. Naunyn Schmiedebergs Arch Pharmacol 374: 195–206, 2006.[CrossRef][Web of Science][Medline]
  49. Reffelmann T, Kloner RA. Transthoracic echocardiography in rats. Evaluation of commonly used indices of left ventricular dimensions, contractile performance, and hypertrophy in a genetic model of hypertrophic heart failure (SHHF-Mcc-facp-Rats) in comparison with Wistar rats during aging. Basic Res Cardiol 98: 275–284, 2003.[CrossRef][Web of Science][Medline]
  50. Reid MJ, Lame MW, Morin D, Wilson DW, Segall HJ. Involvement of cytochrome P450 3A in the metabolism and covalent binding of 14C-monocrotaline in rat liver microsomes. J Biochem Mol Toxicol 12: 157–166, 1998.[CrossRef][Medline]
  51. Rosner BA. Fundamentals of Biostatistics. Pacific Grove, CA: Duxbury, 2005.
  52. Scanlon SM, Williams DC, Schloss P. Membrane cholesterol modulates serotonin transporter activity. Biochemistry 40: 10507–10513, 2001.[CrossRef][Medline]
  53. Schenk B, Fernandez F, Waechter CJ. The ins(ide) and out(side) of dolichyl phosphate biosynthesis and recycling in the endoplasmic reticulum. Glycobiology 11: 61R–70R, 2001.[Abstract/Free Full Text]
  54. Shah M, Patel K, Sehgal PB. Monocrotaline pyrrole-induced endothelial cell megalocytosis involves a Golgi blockade mechanism. Am J Physiol Cell Physiol 288: C850–C862, 2005.[Abstract/Free Full Text]
  55. Siddals KW, Marshman E, Westwood M, Gibson JM. Abrogation of insulin-like growth factor-I (IGF-I) and insulin action by mevalonic acid depletion: synergy between protein prenylation and receptor glycosylation pathways. J Biol Chem 279: 38353–38359, 2004.[Abstract/Free Full Text]
  56. Simon AR, Severgnini M, Takahashi S, Rozo L, Andrahbi B, Agyeman A, Cochran BH, Day RM, Fanburg BL. 5-HT induction of c-fos gene expression requires reactive oxygen species and Rac1 and Ras GTPases. Cell Biochem Biophys 42: 263–276, 2005.[CrossRef][Web of Science][Medline]
  57. Slama M, Susic D, Varagic J, Ahn J, Frohlich ED. Echocardiographic measurement of cardiac output in rats. Am J Physiol Heart Circ Physiol 284: H691–H697, 2003.[Abstract/Free Full Text]
  58. Stancu C, Sima A. Statins: mechanism of action and effects. J Cell Mol Med 5: 378–387, 2001.[Web of Science][Medline]
  59. Stenmark KR, McMurtry IF. Vascular remodeling versus vasoconstriction in chronic hypoxic pulmonary hypertension: a time for reappraisal? Circ Res 97: 95–98, 2005.[Free Full Text]
  60. Steudel W, Watanabe M, Dikranian K, Jacobson M, Jones RC. Expression of nitric oxide synthase isoforms (NOS II and NOS III) in adult rat lung in hyperoxic pulmonary hypertension. Cell Tissue Res 295: 317–329, 1999.[CrossRef][Web of Science][Medline]
  61. Suzuki YJ, Day RM, Tan CC, Sandven TH, Liang Q, Molkentin JD, Fanburg BL. Activation of GATA-4 by serotonin in pulmonary artery smooth muscle cells. J Biol Chem 278: 17525–17531, 2003.[Abstract/Free Full Text]
  62. Vevera J, Fisar Z, Kvasnicka T, Zdenek H, Starkova L, Ceska R, Papezova H. Cholesterol-lowering therapy evokes time-limited changes in serotonergic transmission. Psychiatry Res 133: 197–203, 2005.[CrossRef][Web of Science][Medline]
  63. Wanstall JC, Fiore SA, Gambino A, Chess-Williams R. Potentiation of 5-hydroxytryptamine (5-HT) responses by a 5-HT uptake inhibitor in pulmonary and systemic vessels: effects of exposing rats to hypoxia. Naunyn Schmiedebergs Arch Pharmacol 368: 520–527, 2003.[CrossRef][Web of Science][Medline]
  64. Watson LE, Sheth M, Denyer RF, Dostal DE. Baseline echocardiographic values for adult male rats. J Am Soc Echocardiogr 17: 161–167, 2004.[CrossRef][Web of Science][Medline]
  65. Welsh DJ, Harnett M, MacLean M, Peacock AJ. Proliferation and signaling in fibroblasts: role of 5-hydroxytryptamine2A receptor and transporter. Am J Respir Crit Care Med 170: 252–259, 2004.[Abstract/Free Full Text]
  66. Young KA, Ivester C, West J, Carr M, Rodman DM. BMP signaling controls PASMC KV channel expression in vitro and in vivo. Am J Physiol Lung Cell Mol Physiol 290: L841–L848, 2006.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. Homma, T. Nagaoka, V. Karoor, M. Imamura, L. Taraseviciene-Stewart, L. A. Walker, K. A. Fagan, I. F. McMurtry, and M. Oka
Involvement of RhoA/Rho kinase signaling in protection against monocrotaline-induced pulmonary hypertension in pneumonectomized rats by dehydroepiandrosterone
Am J Physiol Lung Cell Mol Physiol, July 1, 2008; 295(1): L71 - L78.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Y. Dempsie, I. Morecroft, D. J. Welsh, N. A. MacRitchie, N. Herold, L. Loughlin, M. Nilsen, A. J. Peacock, A. Harmar, M. Bader, et al.
Converging Evidence in Support of the Serotonin Hypothesis of Dexfenfluramine-Induced Pulmonary Hypertension With Novel Transgenic Mice
Circulation, June 3, 2008; 117(22): 2928 - 2937.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/3/L630    most recent
00110.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Laudi, S.
Right arrow Articles by Steudel, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Laudi, S.
Right arrow Articles by Steudel, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.