|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1Division of Pulmonary, Allergy, and Critical Care Medicine, Department of Medicine, Emory University School of Medicine and 2Atlanta Veterans Affairs Medical Center, Atlanta, Georgia
Submitted 5 January 2007 ; accepted in final form 19 July 2007
| ABSTRACT |
|---|
|
|
|---|
B and mothers against decapentaplegic homolog 3. Fibroblasts cultured in normal (–80 mV) or reduced (–131 mV) Eh Cys/CySS showed less induction. Furthermore, fibronectin expression in response to an oxidized Eh Cys/CySS was associated with expression of transforming growth factor-
1 (TGF-
1) and was inhibited by an anti-TGF-
1 antibody and SB-431542, a TGF-
1 receptor inhibitor. These studies suggest that extracellular oxidant stress activates redox-sensitive pathways that stimulate lung fibroblast proliferation and matrix expression through upregulation of TGF-
1. redox potential; oxidant stress; fibroblasts; fibrosis; fibronectin; proliferation; redox signaling
Several studies in vitro demonstrate that reversible redox reactions of thiol/disulfide couples play roles in the regulation of important cellular processes such as proliferation, differentiation, and apoptosis and have been implicated in human disease (18, 26, 29, 52). Also, various growth factor receptors are sensitive to thiol content and redox (17, 40). Of note, most of the available research on thiol/disulfide couples and oxidative stress has focused on intracellular GSH/GSSG, the most abundant intracellular low-molecular-weight thiol/disulfide couple. However, the extracellular thiol/disulfide redox environment consisting of cysteine (Cys)/cystine (CySS) also appears to be important. This thiol/disulfide redox couple is the predominant low-molecular-weight thiol/disulfide pool found in plasma. In humans, the physiological Cys/CySS redox potential (Eh Cys/CySS) in healthy subjects is around –80 mV, whereas in subjects with disease, this redox state becomes oxidized to between –62 to –20 mV (28). Oxidized Eh Cys/CySS has been documented in subjects with diets low in Cys, alcohol abuse, diabetes, and cigarette smoking (1, 25, 26, 28). These observations are intriguing particularly when considered in conjunction with data showing that alterations in extracellular Eh Cys/CySS redox can drive signal transduction. This is highlighted in the work of Nkabyo and colleagues (40), among that of others, showing activation of epidermal growth factor receptor signaling and induction of the p44/p42 mitogen-activated protein kinase pathway followed by increased proliferation in Caco-2 cells exposed to reduced extracellular Eh Cys/CySS redox. Relevant to our work is the finding that GSH (at physiological concentrations of 0–500 µM) has been found to suppress the proliferation of cultured lung fibroblasts (9). Of note, other sulfhydryl-containing compounds like Cys, N-acetylcysteine, 2-mercaptoethanol, and dithiothreitol also reduce fibroblast proliferation. However, to our knowledge, the effect over the pathophysiological range occurring in vivo of oxidized Eh Cys/CySS on lung fibroblast functions remains unknown.
Together, these studies suggest that extracellular oxidant stress, through oxidation of the Cys/CySS thiol disulfide couple, might directly activate redox-sensitive pathways that stimulate the differential expression of genes that control fibroblast proliferation and matrix deposition. To explore this hypothesis, we cultured lung fibroblasts in the setting of oxidized Eh Cys/CySS and tested for cell proliferation and the expression of fibronectin, a matrix glycoprotein implicated in injury and repair and highly expressed by lung fibroblasts in the setting of fibrotic lung disorders.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Cells were cultured in complete serum-free media with L-glutamine and 1 g/l BSA (Cellgrow Complete 1 x Serum Free/Low Protein Media; Catalog no. 40–101-cv; Mediatech, Herndon, VA) for 24 h before the addition of the redox media. The redox medium was prepared fresh every day and changed every 24 h.
mRNA analysis.
Primary wild-type mouse lung fibroblasts (106 cells/ml) were plated on six-well plates and incubated in complete serum-free media for 24 h before the addition of the redox media for 6 h. Total RNA was isolated as previously described (11). The reverse transcription reactions of the extracted RNA were performed by combining the following reagents in a PCR reaction tube: 0.625 µM dNTPs, 16 nmol random hexamer oligonucleotides (Roche Diagnostics, Indianapolis, IN), 5 µl first-strand buffer (50 mM Tris·HCl, pH 8.3, 75 mM KCl, and 3 mM MgCl2; Invitrogen, Carlsbad, CA), 20 mM DTT, 200 units reverse transcriptase enzyme, 0.5 µl RNasin (ribonuclease inhibitor; Promega, Madison, WI), and 1 µg extracted RNA in a total volume of 25 µl. Primers for PCR reactions were based on GenBank published sequences and are as follows: mouse fibronectin forward primer (CTGTGACAACTGCCGTAG), reverse primer (CAGCTTCTCCAAGCATCG), probe (ACCAAGGTCAATCCACAC); mouse
-actin forward primer (ATGGATGACGATATCGCT), reverse primer (ATGAGGTAGTCTGTCAGGT), probe (GGATGGCTACGTACATGGCT); mouse nuclear factor (NF)-
B p65 forward primer (CTGATGTGCATCGG CAAG), reverse primer (TGCTGGGAAGGTGTAGGG); mouse mothers against decapentaplegic homolog 3 (Smad3) forward primer (GCAT GGACGCAGGTTCTC), reverse primer (TTGCATCCTGGTGGGATC). RT-PCR reactions were performed using the following PCR protocol: 95°C for 30 s, 55°C for 30 s, 72°C for 1 min for 35 cycles. PCR products for NF-
B (p65) and Smad3 were resolved on 1% agarose gels and stained with ethidium bromide, and band sizes were verified.
-Actin mRNA was used as an internal standard.
Real-time RT-PCR reactions were set up by adding the following reagents to Smart Cycler Reaction Tubes: 5 mM MgCl2, 0.2 µM forward and reverse primer (for sequences, see above), 10x Master Mix (Roche LightCycler FastStart Master SYBR Green I), and 500 ng of template cDNA. Samples were briefly centrifuged and processed using the following cycle program using the Cepheid Smart Cycler (Sunnyvale, CA): hold at 95°C for 120 s followed by 35 cycles at temperatures of 95°C for 15 s, 68°C for 30 s, and 72°C for 30 s. Results of the log-linear phase of the growth curve were analyzed by use of the mathematical equation of the second derivative, and relative quantification was performed using the 2–
CT method (34).
Western blot analysis.
Primary wild-type mouse lung fibroblasts (1 x 106 cells/ml) were incubated in complete serum-free media for 24 h before exposure to various media redox states ranging from –46 to –131 mV for another 48 h. Cells were then washed and lysed, and the resulting homogenate was submitted to Western blotting. Protein concentration was determined by the Bradford method (6). Blots were incubated with a polyclonal antibody raised against human fibronectin (antibody F3648; 1:1,000 dilution; Sigma), an antibody specific for phosphor (p)-cAMP response element binding protein (CREB) or total CREB (1:1,000 dilution; Cell Signaling Technology), primary antibodies against Erk-1/2 and p-extracellular signal-regulated kinase (Erk; Tyr204), p-protein kinase C (PCK)-
(Ser657; 1:1,000 dilution; Santa Cruz Biotechnology, Santa Cruz, CA), a primary antibody against Smad3 (Upstate, Lake Placid, NY), or a primary antibody against the COOH-terminal region of PKC
(antibody P-4334; 1:3,000 dilution; Sigma). Identically loaded gels were run and incubated with a primary antibody against actin (abcam 1801; 1:1,000 dilution) to control for loading. Blots were incubated with a secondary rabbit antibody raised against goat IgG conjugated to horseradish peroxidase (1:20,000 dilution). The blots were transferred to freshly made ECL solution (Amersham, Arlington, IL) for 1 min and exposed to X-ray film. Protein bands were quantified by densitometric scanning using a GS-800 Calibrated laser densitometer (Bio-Rad, Hercules, CA).
[methyl-3H]thymidine incorporation assay. Primary wild-type mouse lung fibroblasts (5 x 104 cells/ml) were incubated in complete serum-free media for 24 h before culture under varying Eh Cys/CySS redox conditions for 24–48 h in the presence of 1 µCi/ml [methyl-3H]thymidine (sp act 250 Ci/mmol; Amersham Biosciences). Afterward, the media was removed, and the attached cells were washed with 1x PBS, incubated with ice-cold 6% trichloroacetic acid at 4°C for 20 min, washed one time with 6% trichloroacetic acid, and solubilized in 0.1 N NaOH. An aliquot of the cell extract was counted in a Beckman Coulter LS6500 liquid scintillation counter.
Examination of fibronectin gene transcription.
To evaluate fibronectin gene transcription, primary lung fibroblasts and NIH/3T3 cells expressing pFN(1.2kb)LUC were studied (37, 56). The DNA construct pFN(1.2kb)LUC contains
1,200 bp of the 5'-flanking region of the human fibronectin gene isolated from the human fibrosarcoma cell line HT1080. This construct includes 69 bp of exon 1, a CAAT site located at –150 bp, and the sequence ATATAA at –25 bp from the transcription start site. It also contains several previously identified regulatory elements such as three cAMP response elements located at –415, –270, and –170 bp and an SP-1 site at –102 bp from the transcription start site. The promoter was subcloned in the Sma I site of pGL3 Basic Luciferase Reporter Vector (Promega). The pFN(1.2kb)LUC promoter construct was introduced into murine NIH/3T3 fibroblasts via electroporation to create stable transfectants (37). Both primary fibroblasts and stably transfected NIH/3T3 fibroblasts were maintained in DMEM with 4.5 g/l glucose supplemented with 10% heat-inactivated FBS and 1% antibiotic-antimycotic solution (100 U/ml penicillin G sodium, 100 U/ml streptomycin, and 0.25 µg/ml amphotericin B) and incubated in a humidified 5% CO2 incubator at 37°C. The cells were harvested by trypsinization with 2.5x trypsin and 5.3 mM EDTA (Sigma Chemical, St. Louis, MO), washed with PBS, counted, and plated at 1.5 x 105 cells/ml in 12-well tissue culture dishes. The cells were then incubated in complete serum-free media for 24 h before treatment with various redox state media. Concurrently, for some experiments, cells were treated with nicotine (50 µg/ml) as a positive control (51) for various periods of time in different redox media. In experiments involving 4-acetamide-4'-amleimidylstilbene-2, 2'-disulfonic acid, disodium salt (AMS; Invitrogen), cells were pretreated with AMS (0.5 mM) for 2 h before incubation with the redox state media. Afterward, the cells were tested for luciferase activity. For this, the cells were harvested by scraping, washed with PBS, resuspended in 100 µl of cell lysis buffer (Promega), and sonicated, and a 10-µl aliquot was tested by adding 50 µl Luciferase assay reagent (Promega). Light intensity was measured using a Labsystems Luminoskan Ascent Plate Luminometer. Results were recorded as luciferase units adjusted for total protein content that was measured using the Bradford method (6).
Statistical evaluation. The data shown represent results from a single representative experiment with four to eight replicates within a single experiment. Each experiment was performed at least three times. Means ± SE were calculated for all experimental values. Significance was assessed by ANOVA followed by Student's t-test.
| RESULTS |
|---|
|
|
|---|
|
Induction of redox signaling in lung fibroblasts. To study the signaling events elicited by Eh Cys/CySS, we studied lung fibroblasts and measured fibronectin gene transcription. Previously, we found that fibronectin expression is controlled by activation of PKC and mitogen-activated protein kinase Erk 1/2, and by induction of the transcription factor CREB (37); therefore, we focused on these signals for further study. As demonstrated in Fig. 2A, we found that an oxidized Eh Cys/CySS redox potential enhanced the expression of total and phosphorylated forms of PKC and that an inhibitor of PKC activation (calphostin C) blocked redox stimulation of fibronectin. A second inhibitor of PKC activation, chelerythrine chloride, also blocked this effect (Fig. 2B). In contrast, an inhibitor of mitogen/extracellular signal-regulated kinase (MEK)-1 (PD-98059) did not inhibit the stimulation of fibronectin by an oxidized Eh Cys/CySS redox potential (Fig. 2C). Instead, in cells treated with the MEK-1/Erk inhibitor, fibronectin gene transcription remained elevated in normal and reduced states, suggesting that this pathway might control baseline expression of the fibronectin gene.
|
1, serum, phorbol 12-myristate, 13-acetate, and several other stimulants (16, 37).
|
We then determined that the effects of oxidized Eh Cys/CySS conditions were indeed related to alterations in redox signaling caused by changes in the extracellular relative concentrations of Cys and CySS. This was accomplished by treating fibroblasts with varying redox conditions in the presence or absence of a non-cell-permeable thiol-reacting reagent, AMS. AMS is a reagent that conjugates to thiols and blocks thiol/disulfide interactions (19). As depicted in Fig. 4, an oxidized Eh Cys/CySS redox media stimulated fibronectin gene transcription, whereas the control and reduced media had no effect. Pretreatment with AMS inhibited the induction of fibronectin in the setting of oxidized Eh Cys/CySS.
|
1.
TGF-
1 is a fibroblast-derived factor that can stimulate fibronectin expression (16). To test the role of TGF-
1 in redox induction of fibronectin, we exposed lung fibroblasts to the various redox states for 24 h and then tested the media for TGF-
1 protein. As shown in Fig. 5A, oxidized Eh Cys/CySS redox potential stimulated TGF-
1 protein accumulation in the media. Specifically, cells showed increased expression of latent (40 kDa) and active (23 kDa) TGF-
1 protein. Most importantly, an antibody against TGF-
1 inhibited redox induction of fibronectin, whereas a control antibody had no effect (Fig. 5B). Similar results were obtained with the use of SB-431542, a potent and selective TGF-
1 receptor inhibitor (Fig. 5C).
|
B and Smad3.
In fibrotic lung disease, fibrosis can be increased by the rate of matrix deposition along with the remodeling of the existent extracellular matrix. Fibrosis can also be affected by an increase in the number of fibroblasts. Therefore, we examined whether Eh Cys/CySS affected cell proliferation in thymidine incorporation assays. We found that, in addition to stimulation of fibronectin expression, oxidized Eh Cys/CySS stimulates fibroblast proliferation. As depicted in Fig. 6, fibroblasts cultured for up to 48 h in oxidized Eh Cys/CySS media showed stimulation of growth, whereas proliferation in normal or reduced media did not differ from control.
|
B (the p65 subunit) and Smad3 mRNA (Fig. 7, A and B) and protein (Fig. 7C) levels were found to be increased in the setting of an oxidized Eh Cys/CySS, with less effects noted in the control condition or in normal or reduced media.
|
| DISCUSSION |
|---|
|
|
|---|
The studies presented herein point to oxidant stress produced by an oxidized extracellular Eh Cys/CySS redox potential as an important modulator of fibroblast proliferation and matrix expression. The Eh Cys/CySS redox pool is sensitive to many host factors (e.g., aging and smoking) and can activate genes and transcription factors that control cell proliferation, transdifferentiation, and apoptosis (27, 39). Because the Eh Cys/CySS redox couple represents the predominant low-molecular-weight thiol/disulfide pool found in plasma (28), it makes sense to study how alterations in this redox couple may promote fibroproliferation and matrix expression.
We found that an oxidized extracellular Eh Cys/CySS stimulates the expression of fibronectin through specific signaling pathways that include phosphorylation of CREB and induction of fibronectin gene transcription. The ability of oxidized extracellular Eh Cys/CySS to stimulate fibronectin expression is significant for the following reasons. Fibronectin is a cell-adhesive extracellular matrix glycoprotein that is rapidly expressed after tissue injury. It has been found to be elevated in most acute and chronic forms of clinical and experimental lung injury, especially in fibrotic lung disorders, and it is for this reason that fibronectin is considered a sensitive marker of tissue injury (32, 48, 49). Unfortunately, the study of fibronectin has been hampered by the fact that knockout mutations of fibronectin lead to early embryonic lethality (18). Nevertheless, its functions have been surmised through many studies in vitro revealing the effects of fibronectin in diverse cell types. Fibronectin promotes the proliferation of fibroblasts, aids the deposition of collagen, stimulates the chemotaxis of monocytes and other immune cells, and induces cytokine production in macrophages (4, 10, 12, 20, 41, 42). With regard to the latter, we have reported that fibronectin induces the transcription factors activator protein-1 and NF-
B in human monocytic cells (50). These factors stimulate the transcription of genes coding for cytokines with proinflammatory capabilities, including TNF-
and interleukin-1
(10, 50). These and other observations have implicated fibronectin in complex processes involved in angiogenesis, oncogenesis, inflammation, and wound healing (32, 49). Because fibronectin stimulates the proliferation and decreases the apoptosis of nonsmall cell lung carcinoma cells (21, 22), the present findings also suggest that increased expression of fibronectin in lung (as seen in tobacco-related and fibrotic chronic lung disorders) might provide a fertile substrate for the proliferation of tumors. This, among other factors, might help to explain the higher incidence of lung cancer found in patients with fibrotic lung diseases (57).
We (37) and others (16, 31, 54) have demonstrated that fibronectin induction in fibroblasts is dependent on distinct signals that include the activation of protein kinases and the induction of the transcription factor CREB. The growth factor transforming growth factor (TGF)-
1, phorbol esters, and serum, among other stimulants, also increase CREB (16, 37). In the current study, an oxidized extracellular Eh Cys/CySS was found to stimulate fibronectin expression through activation of PKC and induction of CREB. Other signals stimulated include induction of NF-
B and Smad3, transcription factors also known for their ability to promote matrix expression. These findings suggest that the extracellular Eh Cys/CySS state can stimulate intracellular signaling termed "redox signaling." Redox signaling is known to control cellular growth and other processes through at least three different redox-dependent processes. One of these processes involves cellular GSH (23), whereas the second involves reactive oxygen species, which are generated during growth signaling in experiments activating receptor tyrosine kinases (30). The third process involves Cys and is the one tested here. Unlike the other two processes, it is extracellular, and it is mediated by the redox state of the Cys/CySS pool (24, 39). Cys is a precursor of GSH, and Cys or CySS can independently affect cell proliferation by altering the available Cys and CySS pool.
We also explored whether the stimulatory effects of Eh Cys/CySS were the result of indirect induction of soluble factors capable of stimulating fibronectin expression. We focused on TGF-
1 because it has been shown to be highly expressed in injured lungs and because it affects both cellular proliferation and matrix expression (7, 33). Our studies show that an oxidized Eh Cys/CySS stimulates TGF-
1 expression and that an antibody against TGF-
1 and a TGF-
1 receptor inhibitor blocked redox induction of fibronectin. This suggests that TGF-
1 mediates the effects of extracellular oxidized Eh Cys/CySS on fibronectin expression. This finding further strengthens our idea that the extracellular Eh Cys/CySS may modulate fibroblast phenotype since TGF-
1, considered a master switch for tissue remodeling, has been shown to promote myofibroblastic transdifferentiation (44, 58). In preliminary work, we have shown that an oxidized Eh Cys/CySS can promote
-smooth muscle actin expression in lung fibroblasts (unpublished observations).
It should be noted that, although the induction of fibronectin (and other variables) was consistent in fibroblasts cultured in the setting of oxidized Eh Cys/CySS (i.e., –46 mV), we observed variations in the intensity of this response. We also observed some induction of fibronectin, albeit less, in the other redox states tested (–80 and –131 mV), but these changes were not consistent. We believe that these findings can be explained by at least two sources of variation in our system. First, this work was conducted in primary lung fibroblasts. Such systems often show some variability when tested repeatedly. It is for this reason that we always conducted the studies multiple times and with the inclusion of appropriate controls. We also used cells between passages 2 and 8, since the variation seemed to intensify when using higher passage number cells. The second source of variability relates to the control of the redox state since it is difficult to consistently control the redox state over prolonged periods of time because of the many variables that affect it. Despite the above, our results are consistent in showing that the more oxidized the Eh Cys/CySS is, a more intense upregulation of fibronectin gene transcription is observed. Finally, although the studies performed with AMS suggest that Cys/CySS signaling results as a consequence of thiol/thiol interactions, it is possible that Cys/CySS themselves (not the redox potential) could also promote signaling events. This possibility cannot be entirely discarded at this point in time.
Having examined the effects of Eh Cys/CySS on fibronectin expression, we tested its effects on lung fibroblast proliferation. This finding might explain the fibroproliferative response observed in chronic lung fibrosing disorders. This stimulatory effect might represent a direct effect of redox signaling on genes involved in the control of the cell cycle or might have been induced indirectly through the induction and/or activation of growth factors. Because fibronectin was stimulated, fibronectin itself might have contributed to the observed fibroblast proliferation, since it has been shown to stimulate the proliferation of these and other lung cells (4).
The implications of these in vitro findings to the clinical arena are significant. In humans, physiological extracellular Eh Cys/CySS in healthy subjects is around –80 mV, whereas, in subjects with disease, this redox may vary between –62 to –20 mV (2). The Jones group and others have documented oxidized Eh Cys/CySS in subjects with diets low in Cys, alcohol abuse, diabetes, and cigarette smoking (1, 8, 9, 25, 28). Because we have examined physiologically relevant redox potentials, one can postulate that oxidation of the Eh Cys/CySS (through deficient diet, drugs, disease) contributes to phenotypic alterations in lung fibroblasts and the generation of a microenvironment that promotes fibroproliferation and lung scarring. Further studies are needed to test the exact contribution of this process in the clinical arena and to determine whether interventions to normalize oxidized Eh Cys/CySS can have therapeutic effects.
In conclusion, we found that extracellular oxidant stress, through oxidation of the thiol/disulfide couple Cys/CySS, activates redox-sensitive pathways that stimulate the differential expression of genes that control the phenotype of fibroblasts in ways that enhance fibroblast proliferation and matrix deposition. This "altered" fibroblast deposits an aberrant matrix characterized by increased relative concentrations of fibronectin through upregulation of TGF-
1.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
and its receptor antagonist in human mononuclear cells. Am J Physiol Lung Cell Mol Physiol 271: L61–L69, 1996.
CT method. Methods 25: 402–408, 2001.[CrossRef][Web of Science][Medline]
5
1 integrin. J Clin Invest 89: 61–67, 1992.[Web of Science][Medline]
gene by fibronectin: Role of protein kinase C and activator protein-1 (AP-1). Cytokine 12: 1581–1596, 2000.[CrossRef][Web of Science][Medline]This article has been cited by other articles:
![]() |
S. S. Iyer, D. P. Jones, K. L. Brigham, and M. Rojas Oxidation of Plasma Cysteine/Cystine Redox State in Endotoxin-Induced Lung Injury Am. J. Respir. Cell Mol. Biol., January 1, 2009; 40(1): 90 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Iyer, A. M. Ramirez, J. D. Ritzenthaler, E. Torres-Gonzalez, S. Roser-Page, A. L. Mora, K. L. Brigham, D. P. Jones, J. Roman, and M. Rojas Oxidation of extracellular cysteine/cystine redox state in bleomycin-induced lung fibrosis Am J Physiol Lung Cell Mol Physiol, January 1, 2009; 296(1): L37 - L45. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Jones Radical-free biology of oxidative stress Am J Physiol Cell Physiol, October 1, 2008; 295(4): C849 - C868. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Nandedkar, T. R. Feroah, W. Hutchins, D. Weihrauch, K. S. Konduri, J. Wang, R. C. Strunk, M. R. DeBaun, C. A. Hillery, and K. A. Pritchard Histopathology of experimentally induced asthma in a murine model of sickle cell disease Blood, September 15, 2008; 112(6): 2529 - 2538. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |