AJP - Lung Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 293: L1359-L1368, 2007. First published September 28, 2007; doi:10.1152/ajplung.00130.2007
1040-0605/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/L1359    most recent
00130.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lei, W.
Right arrow Articles by Harrod, K. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lei, W.
Right arrow Articles by Harrod, K. S.

Transactivation of lung lysozyme expression by Ets family member ESE-1

Wanli Lei, Richard J. Jaramillo, and Kevin S. Harrod

Infectious Diseases Program, Lovelace Respiratory Research Institute, Albuquerque, New Mexico

Submitted 2 April 2007 ; accepted in final form 23 September 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Epithelial-specific Ets (ESE) transcription factors, consisting of ESE-1, ESE-2, and ESE-3, are constitutively expressed in distinct epithelia of mucosal tissues, including the lung. Each ESE member exhibits alternative splicing and yields at least two isoforms (a and b) with transcriptional targets largely unidentified. The studies described herein define a novel role for ESE transcription factors in transactivation of the human lysozyme gene (LYZ), an essential component of innate defense in lung epithelia. Of the six ESE isoforms, ESE-1a and ESE-1b transactivated LYZ promoter in reporter gene assays, whereas only ESE-1b dramatically upregulated transcription of endogenous LYZ in both nonpulmonary and pulmonary epithelial cells. Importantly, ESE-1a and ESE-1b could transactivate the LYZ promoter in cultured primary airway epithelial cells. ESE-2 and ESE-3 isoforms were unable to substantially transactivate the lysozyme promoter or upregulate transcription of endogenous LYZ. Two functional consensus Ets sites located in the proximal 130-bp LYZ promoter were responsive to ESE-1b as identified by site-directed mutagenesis and DNA binding assays. Short hairpin RNA attenuation of endogenous ESE-1b mRNA levels in lung epithelia resulted in decreased LYZ transcription. Furthermore, ESE-1 antibody specifically enriched the 130-bp proximal LYZ promoter in chromatin immunoprecipitation analyses. These findings define a novel role for ESE transcription factors in regulating lung innate defense and suggest distinct regulatory functions for ESE family members.

airway epithelia; Ets proteins; transcriptional regulation; mucosal innate defense


GENE EXPRESSION IS TIGHTLY controlled, in part, through transcription factors binding to DNA motifs (21). In different tissue subsets, the transcriptomes are imparted by expression or functional control of distinct transcriptional regulators. Ets (E26 transforming specific) proteins are a superfamily of transcription factors containing a highly conserved "Ets domain" that recognizes the core motif GGA with specificities further defined by flanking nucleotide sequences (19, 27). Based on amino acid identities of the Ets domain and the presence of other conserved domains, such as the pointed domain, Ets proteins can be classified into several subfamilies (27), including the newly emerging subfamily epithelial-specific Ets (ESE) proteins. Consisting of three distinct genes, ESE-1 (1, 8, 10, 23, 30), ESE-2 (24, 33), and ESE-3 (4, 15, 29), each ESE member yields at least two isoforms (a and b) through alternative splicing (15, 23, 24).

ESE proteins are constitutively expressed in many subtypes of mucosal epithelia with highest expression found in the airway epithelia (14). Their transcriptional targets in these uniquely differentiated cells have not been well-defined. Mucosal epithelia are essential components of innate immunity, not only providing an anatomic barrier, but also contributing actively to host defense by secreting a plethora of proteins such as lysozyme and lactoferrin (3, 12, 28). Transcriptional mechanisms coordinating the expression of these host defense proteins in mucosal epithelia are poorly understood. Various reports of Ets family members regulating expression of host defense genes are suggestive, but definitive elucidation of mechanisms in the lung epithelium are not defined yet.

Herein, LYZ is identified as a transactivation target of ESE-1 but not ESE-2 and ESE-3 isoforms. Specifically, ESE-1b transactivates the LYZ promoter through two consensus Ets binding sites in the proximal promoter region. We also provide evidence that ESE isoforms have differential regulating potentials on the LYZ promoter. These studies provide a foundation for elucidating the transcriptional networks in mucosal tissues such as regulating coordinated host defense gene expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell culture, transfection, and reporter gene assays. This study was reviewed and approved by the Lovelace Respiratory Research Institute (LRRI) Institutional Biosafety Committee and the LRRI Institutional Review Board for human research. Normal human bronchial epithelial (NHBE) cells were purchased from Lonza and kept in bronchial epithelial basal medium (BEBM, CC-3171; Cambrex) without retinoic acid; air-liquid interface (ALI) culture of NHBE cells were carried out with protocols provided in mixture of BEBM and DMEM-high glucose (D6429; Sigma) at the ratio of 1:1. The epithelial cell lines A549, H292, and H441, immortalized or transformed cells of human lung epithelial origin, were maintained in RPMI 1640 (Invitrogen) medium containing 10% FBS; human cervical epithelial cells (HeLa) were maintained in Advanced MEM (Invitrogen) containing 10% FBS. Cells were seeded onto 48-well plates (2 x 104 cells per well) 24 h before the experiment and transfected with FuGENE 6 (Roche) as recommended by the manufacturer. Typically, 100 ng of reporter plasmid, 25 ng of ESE expression vector, and various amounts of empty expression vector were added to a total 200 ng per well. For competition assays, 25 ng each of ESE-1b and ESE-2 or ESE-3 isoform expression vector were cotransfected. Twenty-four hours after transfection, cells were washed once with cold PBS, followed by adding 100 µl of 1x lysis buffer (Promega) per well, and kept at –70°C for 1 h. After 30 min of rotation at room temperature, 5 µl of lysates was mixed with 25 µl of substrate (Promega) to detect luciferase activity. Because ESE factors affect transcriptional activity of cytomegalovirus (CMV) or thymidine kinase promoters, we omitted internal control plasmid based on these promoters and carried out the transfections in duplicate; each experiment was repeated at least three times.

Construction of ESE protein expression vectors. ESE-1 and ESE-3 cDNAs were isolated from H441 cells; ESE-2a and ESE-2b cDNAs were isolated from human lung RNA samples. All acquired cDNAs were FLAG-tagged through PCR. RNAs were extracted from H441 cells and human lung tissue with RNeasy mini kits (Qiagen) according to the protocol provided. First-strand cDNA was synthesized with SuperScript First Strand Synthesis System (Invitrogen) and amplified with AccuPrime Taq polymerase (Invitrogen). The primers used are as follows (restriction enzyme sites are shown in italics, and the antisense of FLAG-tag coding sequences are underlined): ESE-1, upstream, 5'-aaagcttatggctgcaacctgtgag-3' (HindIII), downstream, 5'-atctagatcacttatcgtcgtcatccttgtaatcgttccgactctggagaacc-3' (XbaI); ESE-2a, upstream, 5'-aggatccatgccatctctgcctcactc-3' (BamHI); ESE-2b, upstream, 5'-aggatccAtgttggactcggtgacacac-3' (BamHI); ESE-2, downstream, 5'-agaattctcacttatcgtcgtcatccttgtaatctagcttgtcttcctgccacc-3' (EcoRI); ESE-3, upstream, 5'-aggatccatgattctggaaggaggtgg-3' (BamHI), downstream, 5'-actcgagtcacttatcgtcgtcatccttgtaatcgttttcattttctctccatcctc-3' (XhoI). The cDNAs of alternative spliced isoform ESE-1a and ESE-3a were acquired through overlapping/splicing by PCR. PCR products were cloned into pGEM-T vector (Promega) and verified through sequencing. Corresponding cDNAs were subsequently transferred into pcDNA3 (Invitrogen) to achieve an expression vector for each ESE protein. Overexpressed FLAG-tagged ESE-1 proteins were detected with immunoblotting as described in Ref. 18.

Construction of LYZ reporter plasmids and site-directed mutagenesis. DNA was extracted from H441 cells with TRIzol (Invitrogen) according to the protocol provided by the manufacturer and used as the template in the PCR with primers hLysoS (5'-aggtaccactggcctaacaccctatct-3') and hLysoAS (5'-aaagctttgctaggctgaccagggtg-3') to isolate the 3-kb promoter sequence of LYZ (KpnI and HindIII sites are underlined). After cloning into the pGEM-T vector, the LYZ promoter was verified through sequencing, and the corresponding DNA fragment was inserted into pGL3-Basic (Promega) between the KpnI and HindIII sites to get the reporter construct 3.0hLyso. Deletions within the truncated LYZ promoter conferring expression of the luc gene were acquired through enzyme digestion and treatment (1.6hLyso at PvuII, 0.7hLyso at SmaI, 0.38hLyso at NsiI, and 0.13hLyso was constructed through PCR). Transcription factor motifs were analyzed using Match 10.0 software provided within the TRANSFAC database and altered through PCR-based site-directed mutagenesis. In brief, 200 ng of purified 0.38hLyso plasmid was amplified using Pfx DNA polymerase (Invitrogen) with corresponding mutation primer pairs as listed in Table 1 for 14 cycles. Purified PCR products were digested with DpnI for 4 h, and the precipitated DNAs were used to transform XL2-Blue competent cells (Stratagene). The mutated sites were verified through sequencing.


View this table:
[in this window]
[in a new window]

 
Table 1. Sequences of oligos used for EMSA and mutation of putative Ets sites in LYZ proximal promoters

 
EMSA. Because dozens of Ets proteins were expressed in all kinds of epithelial cells, HeLa cells were transfected with pcDNA3 or ESE-1a and ESE-1b expression vector using DreamFect (OZ Biosciences) with the ratio of plasmid to DreamFect at 1:5. Nuclear proteins were extracted with NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce) and quantified with Bradford Reagent purchased from Bio-Rad. Oligos were tagged with a Biotin 3' End DNA Labeling Kit (Pierce) and annealed. EMSA was performed by preincubating each DNA-binding reaction, consisting of 5 mM Tris, 0.5 mM DTT, 0.05 µg/µl poly[dI-dC], 5 mM MgCl2, 80 mM KCl, 0.05% Nonidet P-40, 10 mM EDTA, 2.5% glycerol, and 10 µg of extracted nuclear proteins, at room temperature for 20 min followed by adding 2 µl of biotin-labeled oligos and incubating at room temperature for an additional 20 min. For supershift assay and competition assays, 1 µl of anti-FLAG monoclonal antibody (Sigma) or 100x unlabeled oligos were added into the corresponding binding reaction during preincubation. Twenty microliters of binding mixture containing 1x loading buffer was separated on 5% polyacrylamide gel in 1x Tris-borate-EDTA (TBE) at 100 V, and oligos were electrotransferred to a Hybond nylon membrane (GE Healthcare) in 0.5x TBE. After cross-linking with UV Stratalinker (Stratagene), the biotin-labeled oligos were detected with a LightShift Chemiluminescent EMSA Kit (Pierce).

RT-PCR, semiquantitative RT-PCR, and quantitative PCR analysis. To analyze the transcription of the endogenous LYZ, RNAs were extracted directly from NHBE, HeLa, A549, H292, and H441 cells with the RNeasy mini kit (Qiagen) and used for RT-PCR analysis. One well of ALI cells cultured 2 wk were used for RNA extraction with TRIzol (Invitrogen) according to the manufacturer's instructions. One microgram of total RNA was used to synthesize the first-strand cDNA with QuantiTect Reverse Transcription Kit (Qiagen). FastStart Taq DNA Polymerase (Roche) was used to amplify full LYZ coding sequence (CDS) with primers FF (ctgacctagcagtcaacatg) and FR (ctggagttacactccacaac). In parallel, full GAPDH CDS was amplified as an internal control with primer GS (atcactgccacccagaagac) and primer GR (ttactccttggaggccatgtg). To assess the effects of ESE proteins on the endogenous LYZ, 2 x 105 per well of cells were seeded into six-well plates 1 day before transfection with 500 ng of empty pcDNA3 or corresponding ESE expression vectors. RNAs were extracted 24 h after transfection with TRIzol and reverse-transcribed with QuantiTect Reverse Transcription Kit (Qiagen). Because multiple transcripts containing partial LYZ coding sequence were detected from the epithelial lineage cells, a semiquantitative RT-PCR procedure was employed as previously reported (20) to coamplify full LYZ CDS and GAPDH with optimized primers at 300 nM each of FF and FR vs. 50 nM each of QGF (cgtggaaggactcatgacca) and QGR (gccatcacgccacagtttc). Densities of ethidium-stained PCR bands were analyzed with software provided by Bio-Rad and normalized to corresponding internal controls. QuantiTect SYBR Green PCR Kit (Qiagen) was used to detect mRNA levels of ESE-1 and used in chromatin immunoprecipitation (ChIP) assay with ABI 7300 real-time PCR system (Applied Biosystems). The quantitative PCR results were analyzed with software provided. All assays were repeated at least three times.

Lentivirus-mediated delivery of ESE-1 short hairpin RNA. The 293TN packaging cells (System Biosciences) were cotransfected with lentiviral vector pGIPZ (empty) or V2LHS_17990 [encoding ESE-1 short hairpin RNA (shRNA); Open Biosystems] and packaging plasmids psPAX2/pMD2.G (Addgene) according to Ref. 34. The packaged lentiviral vectors were transduced into A549 cells in the presence of polybrene (6 µg/ml; Millipore) for 6 h, followed by selecting with puromycin (3 µg/ml). Total RNAs were extracted from the survived A549 cells and used for quantitative RT-PCR to detect ESE-1 mRNA levels with primer EQF (gccagatacctcagcgctac) and EQR (ggacacctacgctcttgctc) or used for semiquantitative RT-PCR to detect lysozyme mRNAs as described above.

ChIP analyses. ChIP analyses were carried out with ChIP-IT Express Enzymatic Kit (Active Motif) according to the protocol provided by manufacturer. In brief, three 15-cm dishes of A549 cells (90% confluence) were fixed with 1% formaldehyde for 10 min at room temperature and neutralized with 0.125 M glycine. Released nuclei from collected cells were enzymatically treated at 37°C for 10 min in 1-ml volume, and 50 µl of sheared chromatins were used for immunoprecipitation with normal rabbit serum or polyclonal antibody against ESE-1 (Orbigen). The 110-bp LYZ proximal promoter was amplified with primers LPF (gagtcagtggatcaatagacagttcctg) and LPR (taggctgaccagggtgagctgg). The 130-bp secretoglobin 3A2 (SCGB3A2) promoter contains no consensus Ets sites and was amplified with primers SPF (accctccaaattgtttggtgagaa) and SPR (gcacacacatatttatatgcccattgagg) as negative control to verify the specific enrichment of LYZ proximal promoter fragments by ESE-1 antibody. All ChIP experiments were repeated in triplicate. Specific enrichment of LYZ promoter by ESE-1 antibody was quantified as described above and normalized to the nonspecific precipitation of SCGB3A2 promoter, which does not contain Ets sites.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
LYZ promoter (3.0 kb) is active in various epithelial cells. Lysozyme is constitutively expressed in some subtypes of mucosa epithelium (3, 11, 28). To determine if the human lysozyme gene (LYZ, GenBank acc. no. NM_000239) is expressed in NHBE and cell lines derived from nonpulmonary (HeLa) as well as pulmonary epithelia (A549, H292, and H441), RT-PCR was carried out with RNAs extracted from these cells as templates. The full LYZ CDS could not be detected in undifferentiated NHBE and HeLa cells but was readily detected in A549, H441, and H292 cells (Fig. 1A). Interestingly, the differentiated NHBE cells express higher levels of LYZ mRNAs as detected after 2 wk of ALI culture (Fig. 1B). To assess LYZ promoter function across different epithelial cells, a reporter construct containing 3.0 kb of the LYZ promoter (3.0hLyso) was constructed to confer the expression of firefly luciferase gene (luc). This reporter construct exhibited a strong basic transcriptional activity in all cells studied (Fig. 1C), indicating there are positive regulators for LYZ promoter activity in pulmonary and nonpulmonary epithelial cells. These findings suggest that other mechanisms beyond transcriptional activation may regulate LYZ expression across various epithelial cells. Furthermore, these findings provide a basis for studying transcription factor-mediated regulation of LYZ.


Figure 1
View larger version (8K):
[in this window]
[in a new window]

 
Fig. 1. AC: transcription of the endogenous human lysozyme gene (LYZ) and LYZ promoter function in pulmonary and nonpulmonary epithelial cells. A: transcription of LYZ in different epithelial cells was detected through RT-PCR (35 cycles). Abundance of GAPDH was used as an internal control. B: full-length LYZ coding sequence (CDS) could be detected in differentiated air-liquid interface (ALI) cultures but not in the undifferentiated human bronchial epithelial (NHBE) cells. C: basic transcriptional activity of reporter construct 3.0hLyso in epithelial cells (white bar) was compared with empty reporter vector pGL3 (set to 1.0, black bar). All the reporter assays in this study were carried out in duplicate and repeated at least 3 times. The data displayed here is a representative sample. Values represent means ± SE. HeLa, human cervical epithelial cells.

 
Transactivation of the LYZ promoter by ESE-1. ESE proteins are potential candidates for regulating transcription of LYZ due to the coexpression pattern in many mucosal epithelia and numerous putative Ets binding sites located upstream of the LYZ transcription start site. Expression vectors for the six ESE family isoforms were constructed as detailed in MATERIALS AND METHODS and used for cotransfection studies with 3.0hLyso to assess their effects on the LYZ promoter. As shown in Fig. 2A, ESE-1a and ESE-1b dramatically transactivated the LYZ promoter in NHBE, A549, and HeLa cells with ESE-1a exhibiting weaker transactivating capacities, whereas ESE-2 and ESE-3 isoforms differentially transactivated this reporter construct in different cells yet never reaching the levels of transactivation induced by ESE-1.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 2. AC: transactivation of the LYZ promoter by epithelial-specific Ets (E26 transforming specific) transcription factor-1 (ETS-1). A: ESE-1 isoforms transactivate the LYZ promoter in A549, HeLa, and NHBE cells. Basic transcriptional activity of 3.0hLyso is set as 1.0. None of the ESE proteins showed obvious transactivation on pGL3 (data not shown). B: the effects of ESE isoforms on transcription of endogenous LYZ were analyzed by semiquantitative RT-PCR (35 cycles), shown in the order of CMV3, ESE-1a, ESE-1b, ESE-2a, ESE-2b, ESE-3a, and ESE-3b. Densitometry was carried out with Quantity One software (Bio-Rad). The fold changes after normalization with corresponding internal control are showed at the bottom. Density of the pcDNA3-treated sample was set as 1 in A549 cells. In HeLa cells, only ESE-1b induced the expression of endogenous LYZ and could not be normalized; therefore, its density was set as 1, and others were set at 0, indicating a lack of expression. C: overexpressed ESE-1a and ESE-1b in A549 as well as HeLa cells were detected by immunoblotting with anti-FLAG monoclonal antibody, and beta-actin was used as loading control. Alone, empty vector; CMV3, empty vector; 1a, ESE-1a; 1b, ESE-1b.

 
To test if the ESE proteins could transactivate endogenous LYZ, an individual ESE expression vector was transfected into A549 and HeLa cells. We optimized a semiquantitative RT-PCR protocol based on the primer FF and FR to coamplify the full-length LYZ CDS and internal control GAPDH with QGF and QGR. As shown in Fig. 2B, ESE-1b markedly upregulated transcription of endogenous LYZ in both A549 and HeLa cells. ESE-2 and ESE-3 isoforms could not upregulate the basal transcription of endogenous LYZ in either cell line. The differential transactivating capacities of ESE-1a and ESE-1b are not related to their protein levels as detected by immunoblotting (Fig. 2C). These findings using both promoter-driven reporter assays and endogenous gene expression indicate that ESE-1 isoforms, particularly ESE-1b, can induce LYZ expression in mucosal epithelial cells.

Attenuation of ESE-1b transactivation by other ESE members. Ets transcription factors are known to bind overlapping consensus DNA motif (27), suggesting that competition between coexpressed ESE members may have biological significance such as the ablation of LYZ transcription in A549 cells. To test this in LYZ promoter regulation, ESE-2 and ESE-3 isoform expression vectors were cotransfected in conjunction with the ESE-1b expression vector and 3.0hLyso. Coexpression of ESE-2a, ESE-3a, or ESE-3b reduced the transactivation of the LYZ promoter by ESE-1b in both A549 and HeLa cells (Fig. 3). Interestingly, coexpression of ESE-2b with ESE-1b did not alter transactivation of the LYZ promoter in A549 cells but was able to attenuate ESE-1b transactivation in HeLa cells, suggesting ESE-2b may have unique cell-specific mechanisms for transactivation of the LYZ promoter. The overall findings suggest that competition by multiple ESE family members for distinct Ets consensus sites may not be a critical mechanism in ESE-mediated transcriptional regulation.


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 3. Competition between ESE-2 or ESE-3 isoforms and ESE-1b is shown. Cotransfection of ESE-2 or ESE-3 isoforms with ESE-1b reduced transactivation of the LYZ promoter by ESE-1b. ESE-2b showed potentiation in pulmonary cell A549 and ablation in nonpulmonary HeLa cells. Values represent fold changes (means ± SE).

 
Identification of the proximal promoter sequences responsive to ESE-1b. To map the corresponding ESE-1b-responsive cis element(s) in the LYZ promoter, reporter plasmids containing truncated LYZ promoters conferring the luc reporter gene were constructed (Fig. 4A). Each of the truncated promoter constructs was functional in HeLa, A549, H292, and H441 cells (data not shown). The 0.13-kb truncated promoter was sufficient for transactivation by ESE-1b in both A549 and HeLa cells (Fig. 4B). Interestingly, the 3.0- and 1.7-kb promoters exhibited diminished transactivation by ESE-1b in HeLa cells but not in A549 cells, suggesting that there are potential inhibitory elements functional in the 1.7- to 3.0-kb upstream region in HeLa but not A549 cells. Regardless, the findings from these experiments indicate that the proximal 130-bp LYZ promoter contains cis element(s) responsive to ESE-1b in both pulmonary and nonpulmonary cell lineages.


Figure 4
Figure 4
View larger version (32K):
[in this window]
[in a new window]

 
Fig. 4. Cis elements responsive to ESE-1 transactivation are located in the proximal LYZ promoter. A: schematic structure of the truncated LYZ promoter constructs conferring expression of the luc reporter gene. B: the proximal LYZ promoter (130 bp) contains the cis element(s) responsive to ESE-1b transactivation in both A549 and HeLa cells. C: 2 putative Ets sites in the LYZ proximal promoter were identified by TRANSFAC software analysis, and each core motif was labeled as I and II (see MATERIALS AND METHODS). D: both site I (Mut I) and site II (Mut II) are required for transactivation by ESE-1b in A549 and HeLa cells as assessed by site-directed mutagenesis. E: core-motif mutation of either site I or site II resulted in decreased basic transcriptional activities of LYZ promoter and lost or decreased response to ESE-1b transactivation in NHBE cells. Values represent fold changes (means ± SE).

 
Two putative Ets sites within the 130-bp proximal LYZ promoter were identified computationally using Match 10.0 of the TRANSFAC database, and these core motifs were designated as motifs I and II, with motif I being the most proximal to the transcription start site (Fig. 4C). To assess whether these sites are responsive to ESE-1b, site-directed mutagenesis was used to alter the core-binding sequence in each putative site with oligos shown in Table 1. Mutation of either motif I or II abolished the transactivation by ESE-1b in A549 cells (Fig. 4D). Similar results were obtained in HeLa cells, with the mutation of motif II showing somewhat less functionality in ESE-1b transactivation than that for motif I. Mutation of either Ets sites resulted in decreased basic transcriptional activities and loss of ESE-1b transactivation in NHBE cells (Fig. 4E), strongly supporting a role for ESE-1b transactivation of the LYZ promoter in primary lung epithelial cells. These findings indicate that both Ets sites located at 39 bp (site I) and 84 bp (site II) upstream of the transcription start site are important for ESE-1b to transactivate LYZ promoter in pulmonary or nonpulmonary epithelial cells.

ESE-1b binding of functional Ets sites. EMSAs were carried out to assess whether ESE-1b could directly bind the two putative Ets sites identified by site-directed mutagenesis. Nuclear proteins from HeLa cells transfected with ESE-1b expression plasmid formed a higher shifted complex with site I or site II oligos (Fig. 5, arrow; sequence of oligos are shown in Table 1). Competition with 100x extra unlabeled wild-type (wt) site I and site II oligos abolished all the bands shifted as expected, whereas competition with the mutant (mut) site I or site II oligos had little effect on the larger shifted complex. In the absence of available antibodies for supershift analyses, the ESE-1b expression vector was constructed as detailed in MATERIALS AND METHODS with a FLAG peptide tagged on the COOH terminus. Addition of anti-FLAG antibody specifically abolished binding of the wt oligo due to the localization of the FLAG epitope adjacent to the DNA binding domain on the COOH terminus of ESE-1b. ESE-1a showed similar binding patterns on site I and site II to that of ESE-1b (data not shown), suggesting that the reduced transactivation of the LYZ promoter by ESE-1a is likely not related to its DNA binding activities.


Figure 5
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 5. Binding of ESE-1b proteins with site I and site II is shown. The FLAG-tagged ESE-1b expression vector was transfected into HeLa cells, and nuclear proteins were extracted for gel shift assay. The additional band specifically shifted by ESE-1b is shown next to the arrow. Binding of wild-type (wt) oligos was wrestled away by excess unlabeled site I or site II oligos but not by mutated excess unlabeled oligos. Sequence of oligos is shown in Table 1. The anti-FLAG antibody specifically abolished the binding of ESE-1b. mut, mutant oligos.

 
Endogenous ESE-1b transactivates LYZ. High levels of ESE-1b but not ESE-1a mRNAs could be detected in A549 cells (data not shown). To assess if endogenous ESE-1b could regulate endogenous LYZ expression, small interfering RNA-mediated knockdown studies were performed. A549 cells were transduced with empty or ESE-1 shRNA encoded lentiviral vectors as detailed in MATERIALS AND METHODS. The shRNA recognizes both ESE-1a and ESE-1b mRNA targets; however, ESE-1b has much greater expression than ESE-1a in A549 cells (data not shown). As shown in Fig. 6A, the LYZ mRNA levels decreased concomitantly with knockdown of ESE-1 mRNA, indicating endogenous LYZ is a transcriptional target of ESE-1b. To further assess ESE-1b binding to the endogenous LYZ promoter, ChIP was employed as detailed in MATERIALS AND METHODS. The rabbit polyclonal antibody against ESE-1 ({alpha}-ESE-1), but not the normal rabbit sera, specifically enriched the 110-bp LYZ promoter containing the ESE-1b-responsive elements. The 110-bp proximal SCGB3A2 promoter contains no consensus Ets sites and was used as a negative control, and no differences could be detected, indicating the specific enrichment of LYZ proximal promoter by ESE-1 antibody. These findings together support that endogenous LYZ is a target for endogenous ESE-1b transactivation in lung epithelial cells.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 6. Endogenous ESE-1b regulates LYZ. A: A549 cells were transduced with lentiviral vectors pGIPZ (empty) or pGIPZ encoding ESE-1 short hairpin RNA (shRNA), and total RNAs were used to detect ESE-1b mRNA through real-time quantitative RT-PCR (left). LYZ mRNA was quantified by densitometry analyses of ethidium bromide-stained PCR bands and normalized to that of GAPDH (right). B: chromatin immunoprecipitation (ChIP) analysis of ESE-1b binding to the Ets motifs in the endogenous LYZ promoter. Quantitative PCR was carried out to verify the specific enrichment of LYZ promoter fragments by antibody against ESE-1 (left). Representative ethidium bromide staining of amplified products after ChIP with normal rabbit serum (Normal) or ESE-1 antibody ({alpha}-ESE-1) is shown. The enzymatically sheared DNAs before immunoprecipitation were used as positive control, and 110-bp secretoglobin 3A2 (SCGB3A2) promoter was amplified as the negative control (right).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The findings presented here indicate the LYZ promoter as a target for the highly tissue-restricted Ets transcription factor ESE-1 in lung epithelia. Interestingly, isoforms encoded by ESE-1 exhibited differential transactivating capacities, with ESE-1b showing greater transactivation activity than ESE-1a in lung epithelial cells. Transactivation of the LYZ promoter by ESE-1b was confined to the proximal 130-bp promoter region containing two functional Ets sites as identified by site-directed mutagenesis analysis and DNA binding assays. Isoforms encoded by ESE-2 or ESE-3 activated the LYZ promoter only marginally. Studies utilizing experimental approaches of both overexpression and endogenous ESE-1b proteins on regulating LYZ confirmed these findings. These studies provide strong evidence for the role of the ESE-1 in conferring LYZ expression in epithelial lineage cell types and extend our knowledge of transcriptional mechanisms regulating lung epithelial-specific gene expression.

The ESE transcription factors constitute an emerging subgroup of the Ets family of winged helix-turn-helix DNA-binding protein (27). Of the three ESE members, the first identified protein ESE-1 has been well-studied and shown to have multiple functions. ESE-1 can transactivate numerous genes including squamous differentiation marker SPRR1 (25), angiopoietin-1 (5), transforming growth factor-beta type II receptor (9, 10, 16), inducible nitric oxide synthase (26), cyclooxygenase 2 (13), and MIP-3{alpha} (17). Studies relating ESE-1 to tissue functions have primarily focused on regulating differentiation of kerotinocytes (6) and corneal epithelia (32) as well as involution of mammary glands during development (22). The findings presented here indicate a role for ESE-1 in regulation of lung epithelial gene expression. Despite the nomenclature of ESE, recent reports indicate ESE family members are expressed in nonepithelial cell types (2, 13, 31), suggesting that their function may extend beyond tissues of epithelial origin. In light of this and the notion that lysozyme can be expressed by nonepithelial cells under certain activated conditions, other transcriptional mechanisms may exist for LYZ gene expression.

Although ESE members demonstrate different target gene specificity (15), the studies presented here also indicate that ESE isoforms probably have unique roles as well. For example, ESE-1b markedly upregulated transcription of endogenous LYZ and LYZ promoter activity in both pulmonary and nonpulmonary epithelial subsets, whereas ESE-1a only marginally upregulated transcription of endogenous LYZ in nonpulmonary epithelial cells. Compared with ESE-1a, ESE-1b has 23 additional amino acids (23) following the acidic transactivation domain encoded by exon 4 (7). This additional stretch of peptide sequence appears to confer stronger transactivating capacities to ESE-1b on LYZ in multiple epithelial cell types. Compared with ESE-2 or ESE-3 isoforms, ESE-1 isoforms have an additional DNA binding domain designated as the "A/T hook" located between the NH2-terminal "pointed domain" and the COOH-terminal Ets domain (1, 23). The role of this A/T hook domain in the LYZ promoter requires further investigation; however, the findings presented here would suggest this region to be critically important in LYZ transactivation.

One critical element in defining the role of novel transcription factors is the delineation of their cis elements for future comparisons across multiple promoters. Ets proteins have a highly conserved DNA binding domain, suggesting these transcription factors may bind similar consensus cis element(s) (27). However, a recent report indicates that different Ets proteins can bind and transactivate unique sets of promoter (14). Our findings reiterate the importance of functional analysis specific to each gene target. In addition, our results are consistent with the notion that ESE transactivation is specific to certain family members with regards to LYZ transactivation, and such specificity may be defined by the binding of other transcription factors to flanking sequences adjacent to the Ets motifs. Indeed, DNA binding studies of Ets consensus motifs identified nuclear proteins that bound to elements aside from Ets sites. Future identification of ESE-1 responsive gene promoters will assist in the verification of specific consensus sites and interactions with other transcription factors.

The data presented here provide new insights into the role of ESE transcription factors in regulation of host defense genes in mucosal tissues. Further studies will be necessary to assess whether ESE-mediated regulation extends to other epithelial-specific host defense components such as defensins, chitinases, and other antimicrobial proteins. Additionally, further studies will be needed to assess the roles of ESE proteins in conjunction with other transcription factors in epithelial-specific regulatory networks.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
K. S. Harrod was supported by National Heart, Lung, and Blood Institute Grants HL-071547 and HL-067790.


    ACKNOWLEDGMENTS
 
We thank Yong Lin, Juanita M. Martinez, and Albert P. Senft for helpful discussions and Kimberly Ortega for assistance with manuscript preparation.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. S. Harrod, Infectious Disease Program, Lovelace Respiratory Research Institute, 2425 Ridgecrest Dr. SE, Albuquerque, NM 87108 (e-mail: kharrod{at}lrri.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Andreoli JM, Jang SI, Chung E, Coticchia CM, Steinert PM, Markova NG. The expression of a novel, epithelium-specific ets transcription factor is restricted to the most differentiated layers in the epidermis. Nucleic Acids Res 25: 4287–4295, 1997.[Abstract/Free Full Text]
  2. Appel S, Bringmann A, Grunebach F, Weck MM, Bauer J, Brossart P. Epithelial-specific transcription factor ESE-3 is involved in the development of monocyte-derived DCs. Blood 107: 3265–3270, 2006.[Abstract/Free Full Text]
  3. Bals R, Hiemstra PS. Innate immunity in the lung: how epithelial cells fight against respiratory pathogens. Eur Respir J 23: 327–333, 2004.[Abstract/Free Full Text]
  4. Bochert MA, Kleinbaum LA, Sun LY, Burton FH. Molecular cloning and expression of Ehf, a new member of the ets transcription factor/oncoprotein gene family. Biochem Biophys Res Commun 246: 176–181, 1998.[CrossRef][Web of Science][Medline]
  5. Brown C, Gaspar J, Pettit A, Lee R, Gu X, Wang H, Manning C, Voland C, Goldring SR, Goldring MB, Libermann TA, Gravallese EM, Oettgen P. ESE-1 is a novel transcriptional mediator of angiopoietin-1 expression in the setting of inflammation. J Biol Chem 279: 12794–12803, 2004.[Abstract/Free Full Text]
  6. Cabral A, Fischer DF, Vermeij WP, Backendorf C. Distinct functional interactions of human Skn-1 isoforms with Ese-1 during keratinocyte terminal differentiation. J Biol Chem 278: 17792–17799, 2003.[Abstract/Free Full Text]
  7. Chang CH, Scott GK, Baldwin MA, Benz CC. Exon 4-encoded acidic domain in the epithelium-restricted Ets factor, ESX, confers potent transactivating capacity and binds to TATA-binding protein (TBP). Oncogene 18: 3682–3695, 1999.[CrossRef][Web of Science][Medline]
  8. Chang CH, Scott GK, Kuo WL, Xiong X, Suzdaltseva Y, Park JW, Sayre P, Erny K, Collins C, Gray JW, Benz CC. ESX: a structurally unique Ets overexpressed early during human breast tumorigenesis. Oncogene 14: 1617–1622, 1997.[CrossRef][Web of Science][Medline]
  9. Chang J, Lee C, Hahm KB, Yi Y, Choi SG, Kim SJ. Over-expression of ERT(ESX/ESE-1/ELF3), an ets-related transcription factor, induces endogenous TGF-beta type II receptor expression and restores the TGF-beta signaling pathway in Hs578t human breast cancer cells. Oncogene 19: 151–154, 2000.[CrossRef][Web of Science][Medline]
  10. Choi SG, Yi Y, Kim YS, Kato M, Chang J, Chung HW, Hahm KB, Yang HK, Rhee HH, Bang YJ, Kim SJ. A novel ets-related transcription factor, ERT/ESX/ESE-1, regulates expression of the transforming growth factor-beta type II receptor. J Biol Chem 273: 110–117, 1998.[Abstract/Free Full Text]
  11. Fahlgren A, Hammarstrom S, Danielsson A, Hammarstrom ML. Increased expression of antimicrobial peptides and lysozyme in colonic epithelial cells of patients with ulcerative colitis. Clin Exp Immunol 131: 90–101, 2003.[CrossRef][Web of Science][Medline]
  12. Ganz T. Antimicrobial polypeptides. J Leukoc Biol 75: 34–38, 2004.[Abstract/Free Full Text]
  13. Grall FT, Prall WC, Wei W, Gu X, Cho JY, Choy BK, Zerbini LF, Inan MS, Goldring SR, Gravallese EM, Goldring MB, Oettgen P, Libermann TA. The Ets transcription factor ESE-1 mediates induction of the COX-2 gene by LPS in monocytes. FEBS J 272: 1676–1687, 2005.[CrossRef][Medline]
  14. Hollenhorst PC, Jones DA, Graves BJ. Expression profiles frame the promoter specificity dilemma of the ETS family of transcription factors. Nucleic Acids Res 32: 5693–5702, 2004.[Abstract/Free Full Text]
  15. Kas K, Finger E, Grall F, Gu X, Akbarali Y, Boltax J, Weiss A, Oettgen P, Kapeller R, Libermann TA. ESE-3, a novel member of an epithelium-specific ets transcription factor subfamily, demonstrates different target gene specificity from ESE-1. J Biol Chem 275: 2986–2998, 2000.[Abstract/Free Full Text]
  16. Kim JH, Wilder PJ, Hou J, Nowling T, Rizzino A. Activation of the murine type II transforming growth factor-beta receptor gene: up-regulation and function of the transcription factor Elf-3/Ert/Esx/Ese-1. J Biol Chem 277: 17520–17530, 2002.[Abstract/Free Full Text]
  17. Kwon JH, Keates S, Simeonidis S, Grall F, Libermann TA, Keates AC. ESE-1, an enterocyte-specific Ets transcription factor, regulates MIP-3alpha gene expression in Caco-2 human colonic epithelial cells. J Biol Chem 278: 875–884, 2003.[Abstract/Free Full Text]
  18. Lei W, Liu F, Ness SA. Positive and negative regulation of c-Myb by cyclin D1, cyclin-dependent kinases, and p27 Kip1. Blood 105: 3855–3861, 2005.[Abstract/Free Full Text]
  19. Li R, Pei H, Watson DK. Regulation of Ets function by protein-protein interactions. Oncogene 19: 6514–6523, 2000.[CrossRef][Web of Science][Medline]
  20. Marone M, Mozzetti S, De Ritis D, Pierelli L, Scambia G. Semiquantitative RT-PCR analysis to assess the expression levels of multiple transcripts from the same sample. Biol Proced Online 3: 19–25, 2001.[CrossRef][Medline]
  21. Mitchell PJ, Tjian R. Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245: 371–378, 1989.[Abstract/Free Full Text]
  22. Neve R, Chang CH, Scott GK, Wong A, Friis RR, Hynes NE, Benz CC. The epithelium-specific ets transcription factor ESX is associated with mammary gland development and involution. FASEB J 12: 1541–1550, 1998.[Abstract/Free Full Text]
  23. Oettgen P, Alani RM, Barcinski MA, Brown L, Akbarali Y, Boltax J, Kunsch C, Munger K, Libermann TA. Isolation and characterization of a novel epithelium-specific transcription factor, ESE-1, a member of the ets family. Mol Cell Biol 17: 4419–4433, 1997.[Abstract]
  24. Oettgen P, Kas K, Dube A, Gu X, Grall F, Thamrongsak U, Akbarali Y, Finger E, Boltax J, Endress G, Munger K, Kunsch C, Libermann TA. Characterization of ESE-2, a novel ESE-1-related Ets transcription factor that is restricted to glandular epithelium and differentiated keratinocytes. J Biol Chem 274: 29439–29452, 1999.[Abstract/Free Full Text]
  25. Reddy SP, Vuong H, Adiseshaiah P. Interplay between proximal and distal promoter elements is required for squamous differentiation marker induction in the bronchial epithelium: role for ESE-1, Sp1, and AP-1 proteins. J Biol Chem 278: 21378–21387, 2003.[Abstract/Free Full Text]
  26. Rudders S, Gaspar J, Madore R, Voland C, Grall F, Patel A, Pellacani A, Perrella MA, Libermann TA, Oettgen P. ESE-1 is a novel transcriptional mediator of inflammation that interacts with NF-kappa B to regulate the inducible nitric-oxide synthase gene. J Biol Chem 276: 3302–3309, 2001.[Abstract/Free Full Text]
  27. Sharrocks AD. The ETS-domain transcription factor family. Nat Rev Mol Cell Biol 2: 827–837, 2001.[CrossRef][Web of Science][Medline]
  28. Thompson AB, Robbins RA, Romberger DJ, Sisson JH, Spurzem JR, Teschler H, Rennard SI. Immunological functions of the pulmonary epithelium. Eur Respir J 8: 127–149, 1995.[Abstract]
  29. Tugores A, Le J, Sorokina I, Snijders AJ, Duyao M, Reddy PS, Carlee L, Ronshaugen M, Mushegian A, Watanaskul T, Chu S, Buckler A, Emtage S, McCormick MK. The epithelium-specific ETS protein EHF/ESE-3 is a context-dependent transcriptional repressor downstream of MAPK signaling cascades. J Biol Chem 276: 20397–20406, 2001.[Abstract/Free Full Text]
  30. Tymms MJ, Ng AY, Thomas RS, Schutte BC, Zhou J, Eyre HJ, Sutherland GR, Seth A, Rosenberg M, Papas T, Debouck C, Kola I. A novel epithelial-expressed ETS gene, ELF3: human and murine cDNA sequences, murine genomic organization, human mapping to 1q32.2 and expression in tissues and cancer. Oncogene 15: 2449–2462, 1997.[CrossRef][Web of Science][Medline]
  31. Wang H, Fang R, Cho JY, Libermann TA, Oettgen P. Positive and negative modulation of the transcriptional activity of the ETS factor ESE-1 through interaction with p300, CREB-binding protein, and Ku 70/86. J Biol Chem 279: 25241–25250, 2004.[Abstract/Free Full Text]
  32. Yoshida N, Yoshida S, Araie M, Handa H, Nabeshima Y. Ets family transcription factor ESE-1 is expressed in corneal epithelial cells and is involved in their differentiation. Mech Dev 97: 27–34, 2000.[CrossRef][Web of Science][Medline]
  33. Zhou J, Ng AY, Tymms MJ, Jermiin LS, Seth AK, Thomas RS, Kola I. A novel transcription factor, ELF5, belongs to the ELF subfamily of ETS genes and maps to human chromosome 11p13–15, a region subject to LOH and rearrangement in human carcinoma cell lines. Oncogene 17: 2719–2732, 1998.[CrossRef][Web of Science][Medline]
  34. Zufferey R, Nagy D, Mandel RJ, Naldini L, Trono D. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15: 871–875, 1997.[CrossRef][Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/5/L1359    most recent
00130.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lei, W.
Right arrow Articles by Harrod, K. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lei, W.
Right arrow Articles by Harrod, K. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.