AJP - Lung Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 293: L1463-L1468, 2007. First published October 5, 2007; doi:10.1152/ajplung.00249.2007
1040-0605/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/6/L1463    most recent
00249.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, L.
Right arrow Articles by Fidone, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, L.
Right arrow Articles by Fidone, S.

Enhanced nitric oxide-mediated chemoreceptor inhibition and altered cyclic GMP signaling in rat carotid body following chronic hypoxia

L. He, J. Chen, X. Liu, B. Dinger, and S. Fidone

Department of Physiology, University of Utah School of Medicine, Salt Lake City, Utah

Submitted 28 June 2007 ; accepted in final form 2 October 2007


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Multiple studies have shown that chronic hypoxia (CH) elicits a time-dependent upregulation of carotid body chemoreceptor sensitivity in mammals. In the present study, we demonstrate that enhanced excitation is accompanied by a parallel increase of nitric oxide (NO)-dependent inhibition, which acts via a CH-induced modification of the normal mechanism in O2-sensitive type I cells. The NO synthase inhibitor, NG-nitro-L-arginine methyl ester (L-NAME), elicits a progressively larger increase in carotid sinus nerve (CSN) chemoreceptor activity following incremental increases in CH exposure lasting 1–16 days. The inhibitory effect of the NO donor, S-nitroso-N-acetyl-penicillamine (SNAP), on CSN activity is enhanced following CH. However, the activation of soluble guanylate cyclase (sGC) by SNAP, assessed via production of cGMP, is impaired, along with decreased expression of sGC mRNA transcript. Inhibition of hypoxia-evoked Ca2+ responses by SNAP is mediated via a cGMP/protein kinase G (PKG)-dependent mechanism in normal type I cells that is sensitive to the PKG inhibitor KT-5823, but following CH, inhibitory responses are minimally sensitive to PKG inhibition. The data are consistent with the hypothesis that CH hampers cGMP-mediated inhibition of type I cells in favor of an alternative mechanism.

chemoreceptor sensitivity


PREVIOUS STUDIES IN OUR LABORATORY established that the neuronal isoform of nitric oxide synthase (nNOS), the synthetic enzyme for nitric oxide (NO), is contained in a dense plexus of afferent nerve fibers that terminate near oxygen-sensitive type I cells in rat and cat carotid body. Moreover, a distinct group of nNOS-positive parasympathetic neurons was shown to innervate the carotid body vasculature. Physiological experiments indicated that NO released from these fibers during hypoxia mediated an inhibitory effect on chemoreceptor excitation via dual mechanisms including 1) an axon reflex involving the terminal branches of afferent carotid sinus nerve (CSN) fibers and type I cells, and 2) parasympathetic/NO-induced changes in blood flow involving local vascular elements (24, 27, 28).

Recent studies indicate that chronic hypoxia (CH) increases the expression of multiple NOS isoforms in rat carotid body. Prabhakar and colleagues (20) demonstrated that CH elevates the activity of nNOS in sensory neurons, and Ye et al. (32) recently reported that the inducible form of NOS (iNOS) is expressed in rat type I cells following a 4-wk exposure to 10% O2 breathing. This latter group also showed that tissue levels of NO in carotid body are elevated more than fivefold and that the nonspecific NOS blocker, NG-nitro-L-arginine methyl ester (L-NAME), enhances the chemoreceptor discharge following CH. This upregulation occurred despite the fact that CH decreased the density of NOS immunoreactive fibers in rat carotid body (17).

In the normal carotid body, multiple studies have indicated that NO-induced inhibition is mediated by the activation of soluble guanylate cyclase (sGC) and the production of cGMP (26, 28). In the lung, which is another O2-sensitive tissue, CH selectively impairs the function of sGC in pulmonary, but not thoracic, artery smooth muscle (7). These changes severely dampen pulmonary artery relaxation induced by acetylcholine and a NO donor, sodium nitroprusside. If a similar phenomenon occurs in the carotid body, then NO-mediated chemoreceptor inhibition may be hampered in animals exposed to CH. In the present study, we examine the hypothesis that exposure to CH alters inhibitory NO signaling pathways in rat carotid body type I cells. Our experiments demonstrate that following CH, endogenous NO induces an even greater inhibition of hypoxia-evoked chemoreceptor activity. However, the involvement of sGC and protein kinase G (PKG) in type I cells appears to be greatly lessened in the enhanced inhibitory effects following CH. These findings suggest that CH induces alternative signaling mechanisms for NO inhibition.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals and exposure to CH. Fifty-six rats exposed in a hypobaric chamber were housed in standard rodent cages with food and water. Pressures were reduced from ambient barometric pressure (BP) at Salt Lake City (i.e., BP ~630 Torr; 1,500 m) until a pressure equivalent to 5,500 m (380 Torr) was reached and maintained for a selected period (up to 16 days). The chamber was opened every 2 days to replenish food and water and change litter. Control, normal animals (32 rats), were maintained outside the chamber in ambient conditions. Animal protocols were approved by the University of Utah Institutional Animal Care and Use Committee.

Electrophysiological recording of CSN activity. Under ketamine/xylazine anesthesia, the carotid bifurcations containing the carotid bodies were located, excised, and placed in a lucite chamber containing 100% O2-equilibrated modified Tyrode solution at 0–4°C (in mM: 112 NaCl, 4.7 KCl, 2.2 CaCl2, 1.1 MgCl2, 42 sodium glutamate, 5 HEPES buffer, 5.6 glucose, pH 7.4). Each carotid body along with its attached nerve was carefully dissected from the artery and cleaned of surrounding connective tissue. Preparations were then placed in a conventional flow chamber where the carotid body was continuously superfused (up to 4 h) with modified Tyrode solution maintained at 37°C and equilibrated with a selected gas mixture. The CSN was drawn up into the tip (~100 µm, inner diameter) of a glass suction electrode for monopolar recording of chemoreceptor activity. Basal neural activity was established in superfusates maintained at PO2 = 450 Torr. The PO2 was lowered to 120 Torr in superfusates equilibrated with air to provide a moderately hypoxic stimulus. Neural activity was led to an AC-coupled preamplifier, filtered and transferred to a window discriminator and a frequency to voltage converter. Signals were processed by an AD/DA converter for display of frequency histograms on a PC computer monitor. Data were expressed as impulses per second and analyzed using Student's t-test and ANOVA.

Radioimmunoassay for cGMP. Carotid bodies were removed from ketamine/xylazine-anesthetized rats and cleaned of surrounding connective tissue. Tissues were preincubated for 20–25 min in modified Tyrode solution equilibrated with 100% O2. Selected concentrations of the NO donor, S-nitroso-N-acetyl-penicillamine (SNAP), or the analog of atrial natriuretic peptide (ANP), atriopeptin III [APIII; known to activate the membrane form of guanylate cyclase(6)], were introduced, and incubation continued for 10 min. Following incubation, carotid bodies were immersed in 600 µl of trichloroacetic acid, homogenized, and extracted three times in water-saturated ethyl ether. The aqueous phase was dried, and sealed samples were stored at 4°C. Radioimmunoassay was performed using a commercially available cGMP RIA kit (DuPont NEN; acetylated assay; minimal detectable limit = 2.5 fmol).

Quantitative reverse transcriptase-PCR. In accord with the kit instructions (RNAqueous-Micro; Ambion, Austin, TX), total RNA was extracted from tissue samples pooled from groups of five rats for each experiment. Following removal of contaminating DNA (DNase treatment), first-strand complementary DNA was synthesized from 1 µg of total RNA (quantified with a NanoDrop ND-1000 spectrophotometer) using RETROscript (Ambion). Aliquots of cDNA corresponding to 2 ng of total RNA were introduced into a SybrGreen reaction mix (25 µl; Qiagen) containing selected "upstream" (5'TACATGGAGCTCCGGTAGTTTG3') and "downstream" (5'GACAAAGCACC-TGCCTAGCATT3') primers for sGC. All primer pairs were "blasted" against known rat gene sequences. qPCR was conducted in an MJ Research PTC-200 equipped with a Chromo4 detector. Reactions were initiated at 95°C for 15 min followed by 40 cycles consisting of 30 s at 94°C, 30 s at 58°C, and 30 s at 72°C, with the final cycle extended to 5 min at 72°C. Product purity was evaluated by determination of the melting curve, after which samples were stabilized at 4°C. Sample comparisons were based on the relative standard curve method (21), and data are normalized to 18S rRNA expression. In preliminary studies using cDNA aliquots equivalent to equal amounts of total RNA, we found that 18S rRNA varies less than 10% in CH vs. normal samples with P > 0.24. Amplifications without the RT step were performed to exclude possible contamination with genomic DNA.

Intracellular [Ca2+] measurements. As was described previously (13), freshly dissociated type I cells attached to coverslips were incubated in F-12 medium containing 0.5 µM fura-2 AM for 10–15 min in a CO2 incubator at 36.5°C. Coverslips were placed in a flow chamber where they were superfused with modified Tyrode solution equilibrated with air at 0.75–1.0 ml/min. The temperature was maintained at 35–36.5°C. The chamber was mounted on the stage of a Zeiss inverted microscope incorporated into a Zeiss/Attofluor workstation equipped with an excitation wavelength selector (filter changer) and an intensified charge-coupled device camera system. Fura-2 fluorescent emission was measured at 520 nm in response to alternating excitation wavelengths of 334 and 380 nm. Data were collected and analyzed using Attofluor Ratiovision software (version 6.0).

Statistical analysis. Data were analyzed using Student's t-test or ANOVA with Bonferroni multiple comparison posttests, as appropriate. P values <0.05 were considered as indicating significant differences between groups.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Figure 1 illustrates effects of the nonspecific NOS inhibitor, L-NAME, on basal and hypoxia-evoked chemoreceptor activity recorded in avascular superfused carotid body preparations. The top panel shows three superimposed traces representing integrated CSN activity in a normal preparation and following 3 and 12 days of CH. A separate record indicates bath PO2 in each experiment. In the normal carotid body, the application of 1 mM L-NAME elicited only a slight enhancement in the nerve activity evoked by a standard hypoxic stimulus. Basal nerve activity was unchanged in the presence of the drug, which was introduced into the superfusate 2.5 min before hypoxic stimulation. Following 3 days of CH, the discharge evoked by acute hypoxia was larger than normal in accord with increased chemosensitivity. In addition, the effect of 1 mM L-NAME on the hypoxia-evoked activity was enhanced. Twelve days of CH resulted in a substantially greater elevation of the response to acute hypoxia as well as an even larger response in the presence of L-NAME. Summary data indicate that the effect of L-NAME, expressed as a percent of the averaged evoked discharge, was progressively increased following successive days of CH. The enhanced effect of L-NAME is statistically significant beginning at 3 days (vs. normal) and continues to increase up to day 9 of CH; longer exposure to CH was not associated with further enhancement of the effect of the NOS antagonist. The progressive increase in the effectiveness of L-NAME is similar to the time course of increased carotid body chemosensitivity, which plateaus in the rat after 9 days of CH exposure (5). As was the case in normal carotid body, basal nerve activity in CH preparations was not significantly affected by L-NAME.


Figure 1
View larger version (45K):
[in this window]
[in a new window]

 
Fig. 1. Effect of nitric oxide synthase (NOS) antagonist, NG-nitro-L-arginine methyl ester (L-NAME; 1 mM), on hypoxia-evoked carotid sinus (CSN) nerve activity. Top shows typical results from normal (0-day), 3-day, and 12-day chronic hypoxia (CH) carotid body/CSN preparations superfused in vitro. Each record shows 3 superimposed traces of integrated nerve activity corresponding to 1) a control response to hypoxia, 2) hypoxia-evoked activity in the presence of L-NAME, which was introduced 2.5 min before hypoxia, and 3) recovery, a response evoked 5–10 min following drug washout. A separate trace shows bath PO2. Bottom summarizes hypoxia-evoked CSN activity in the presence of L-NAME as a percentage of the averaged control plus recovery responses for each normal or CH (1–16 days) preparation. N = 3–5 preparations at each time point. * and *** indicate P < 0.05 and 0.001, respectively, vs. normal (i.e., 0-day CH).

 
The effect of the NOS antagonist on hypoxia-evoked chemoreceptor activity is consistent with recent demonstrations of increased NOS expression and NO production in rat carotid body following CH (8, 20, 32). However, these observations may also reflect fundamental changes in NO signaling mechanisms. Thus, in separate experiments, the donor molecule SNAP was used to assess whether CH alters the sensitivity of the carotid body to NO. In these studies, preparations were superfused at a low flow rate to achieve mechanically stable recording conditions. Moreover, because the carotid bodies were avascular, a high superfusate PO2 (450 Torr) was used to establish a normal basal nerve discharge rate. It is well known that NO rapidly reacts with O2 forming NO2 or peroxynitrite, which likely lowered NO concentrations in the recording chamber. These compounds or intermediates are potentially active in biological systems. However, Fig. 2 shows that application of the NO donor SNAP (100 µM), at high PO2, had no effect on basal nerve discharge. As expected, SNAP dampened hypoxia-evoked activity in normal carotid body (Fig. 2, top left). Summary data shown below indicates that SNAP inhibits ~30% of the evoked nerve discharge. However, following 13 days of CH, 100 µM SNAP blocked some 65% of the hypoxia-evoked discharge (elevated due to CH), again without altering basal nerve activity. In CH preparations, we routinely observed a prominent after-discharge (top right) that slowly returned to the resting rate after bath PO2 had been elevated to ~450 Torr. SNAP completely eliminated this phenomenon. In recent studies, we observed that the after-discharge is likewise sensitive to purinergic but not cholinergic antagonists (12, 15).


Figure 2
View larger version (42K):
[in this window]
[in a new window]

 
Fig. 2. Effect of the NO donor S-nitroso-N-acetyl-penicillamine (SNAP; 100 µM) on integrated CSN activity evoked by a standard hypoxic stimulus in vitro. Top shows typical examples of activity in normal and CH preparation. In each case, 3 superimposed traces show activity evoked in the presence of SNAP vs. control and recovery activity recorded before and after exposure to SNAP, respectively. A separate trace shows bath PO2. Summary data at bottom shows that SNAP marginally inhibits evoked activity in normal preparation but markedly dampens CH-induced hyperexcitability. N = 5 normal and 6 CH preparations. ***P < 0.001 vs. control + recovery/2.

 
Figure 3 shows the effect of SNAP (Fig. 3A) and APIII (Fig. 3B), an analog of ANP, on cGMP levels in the carotid body. In normal tissue incubated in 100% O2-equilibrated media in the absence of drugs, cGMP levels were 0.196 ± 0.020 pmol/mg tissue (0 ± SE). Ten-minute incubations in 1.0 µM SNAP did not alter cGMP levels in the tissue. However, 10 µM and 100 µM SNAP and 1, 10, and 100 nM APIII evoked significant dose-related elevations in cGMP. Following a 14-day exposure to CH, APIII evoked significantly larger increases in the concentration of the cyclic nucleotide. But following identical exposure to CH, SNAP at 1, 10, and 100 µM did not stimulate cGMP formation in the tissue. In regard to these results, it is important to note that 100 µM SNAP was a highly effective blocker of hypoxia-evoked CSN activity following CH (Fig. 2). cGMP was elevated in 1,000 µM SNAP, but mean levels of the second messenger at this very high drug concentration were nearly threefold higher in normal vs. CH carotid body. These findings suggest that sGC activity is impaired following CH, whereas the particulate form of the enzyme, which is stimulated by ANP (6), remains intact.


Figure 3
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 3. A and B: dose-response data for SNAP and the atrial natriuretic peptide agonist, atriopeptin III (APIII), on cGMP formation in normal and 14-day CH carotid bodies superfused in vitro. Carotid bodies were incubated in drugs for 10 min before immersion in trichloroacetic acid. * and ** indicate P < 0.05 and 0.01, respectively, vs. normal. N = 3–5 carotid bodies at each point.

 
Loss of responsiveness to SNAP is consistent with decreased expression of sGC, a phenomenon that has been observed previously in rat pulmonary artery smooth muscle following exposure to 24–48 h of hypoxia (11). We therefore examined sGC mRNA transcript levels in carotid body following 0, 3, 7, and 14 days of CH. Data in Fig. 4 show a time-dependent inhibition of sGC expression. Depression of the sGC transcript is evident following 3 days of hypoxia, and it is progressively lowered until, at 14 days, expression is reduced to less than 10% of normal.


Figure 4
View larger version (39K):
[in this window]
[in a new window]

 
Fig. 4. Effect of CH on soluble guanylate cyclase (sGC) transcript expression in rat carotid body (CB). Data were obtained in triplicate real-time quantitative PCR assays from 10 pooled carotid bodies in each group. ***P < 0.001 vs. normal.

 
Figure 5 shows the effect of SNAP and the PKG inhibitor, KT-5823, on a series of hypoxia-evoked Ca2+ responses in dissociated normal vs. CH type I cells. In normal cells (top left), hypoxia evokes a large increase in intracellular Ca2+. This response is significantly attenuated when exposure to hypoxia is repeated in the presence of 100 µM SNAP. Following washout of the drug, sensitivity to hypoxia is fully recovered. The next trial shows that SNAP-mediated inhibition of the hypoxia-evoked Ca2+ response is occluded in the presence of 1.0 µM KT-5823. Again, a subsequent trial with hypoxia following drug washout indicates full recovery of the response. The average response of 12 hypoxia-sensitive cells from one carotid body is shown in the top right panel. A similar experiment in a cell isolated following 14 days of CH (bottom left) shows that SNAP remains a potent inhibitor of the hypoxia-evoked Ca2+ response, but the presence of the PKG inhibitor (KT-5823) only minimally prevents SNAP-induced inhibition. Averaged data from eight cells included in one experiment is shown in the bottom right panel. Data from 42 normal and 64 CH hypoxia-sensitive type I cells, harvested from 2 normal and 2 14-day CH rats, showed similar responses in the presence of SNAP and KT-5823, suggesting the existence of a cGMP/PKG-dependent mechanism of inhibition in normal cells, whereas NO-mediated inhibition in CH type I cells appears to operate largely independently of PKG.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

 
Fig. 5. Fura-2 intracellular Ca2+ measurements on dissociated normal and 14-day CH type I cells. Hypoxia (bath PO2 ~40 Torr) elicits a robust increase in [Ca2+]i in normal cells (top) that is inhibited by 100 µM SNAP; following washout, the response to hypoxia recovers. A second trial with SNAP plus the protein kinase G inhibitor KT-5823 (1.0 µM) blocks inhibition. In cells from a 14-day CH animal (bottom), SNAP also inhibits the hypoxia-evoked response, but the inhibition is insensitive to KT-5823. Traces at left are from single cells; traces at right show averages from 12 normal and 8 CH cells, respectively. Basal [Ca2+]i established in media equilibrated with air (PO2 ~120 Torr).

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The present findings concur with earlier demonstrations of increased NOS expression and NO levels in the rat carotid body following CH (8, 20, 32). Moreover, available data indicate that NOS isoforms produce NO within diverse cell types in carotid body (31, 32). These include vascular endothelial cells, parasympathetic neurons, afferent nerve terminals, and glomus type I cells. Our data using a nonspecific NOS blocker, L-NAME, indicate a progressive increase in endogenous NO production that results in increasing modulation of the chemoreceptor discharge after 1–16 days of CH. Increased CSN activity in the presence of L-NAME is likely due to lessened NO-mediated effects on type I cells in superfused preparations in which vascular function is absent. In addition, L-NAME could act by eliminating direct effects of NO on chemoafferent nerve terminals. This possibility is supported by reports of NO-mediated modulation of activity elicited in petrosal ganglion neurons that send axons into the CSN (2).

Our data extend previous findings by showing that the mechanism of NO-mediated inhibition is fundamentally altered with exposure to CH. Importantly, the NO donor SNAP was a more effective inhibitor of hypoxia-evoked CSN activity in CH preparations. Conceivably, this outcome could result from elevated expression of sGC and increased cGMP production. However, our qPCR data show a decrease in sGC gene expression over a time course that parallels CH-induced increased chemosensitivity. Downregulation of sGC in other tissues has been linked to the action of the inflammatory cytokine, TNF-{alpha} (10, 30). It is thus noteworthy that in recent studies we have found that CH induces immune cell invasion in the carotid body and increased expression of cytokines including TNF-{alpha} (9, 18).

In addition to decreased expression of sGC, radioimmunoassay demonstrated that cGMP levels were not stimulated following CH by concentrations of SNAP that were highly effective inhibitors of the evoked nerve discharge. Altered signaling in the sGC/cGMP pathway appeared to be selective, because parallel assays in tissue treated with an ANP analog indicated enhanced cGMP production following CH. It is well established that ANP (and APIII) stimulates cGMP production via a particulate isoform of GC associated with cell membranes (6). Previous studies in our laboratory showed that ANP and APIII are potent chemoreceptor inhibitors that act in a signaling cascade involving cGMP-mediated activation of PKG (14, 25, 29). The current findings with APIII indicate that ANP signaling may be enhanced following CH. However, our data do not indicate whether signaling mechanisms in other downstream components (i.e., protein phosphatase 2A, PKG) of this pathway are modified in CH type I cells (14).

In normal tissue, the hypoxia-evoked elevation in intracellular Ca2+ was inhibited by SNAP, and this effect was blocked in the presence of the PKG antagonist, KT-5823. These observations confirm the involvement of the cGMP/PKG pathway in mediation of NO-induced chemoreceptor inhibition, and they are in accord with a recent study that demonstrated that NO enhances Ca2+-dependent K+ channel activity in rat type I cells via cGMP/PKG-dependent mechanism (22). However, our data also show that following CH, inhibition of this pathway with the PKG antagonist was substantially reduced, suggesting the involvement of an alternative mechanism. The small effect of KT-5823 in CH type I cells may indicate residual activity in the cGMP/PKG pathway and that NO acts via dual mechanisms to produce inhibition.

Previous studies have shown that NO can mediate multiple effects that are independent of cGMP. Buerk and Lahiri (4) demonstrated decreased O2 consumption in cat carotid body in the presence of NO donors, suggesting possible effects on mitochondrial respiration. However, other studies indicate mitochondrial inhibition mediated by high concentrations of NO produces chemosensory excitation (16, 19). Importantly, Yamamoto et al. (31) localized NO production to type I cell mitochondrial membranes after hypoxia.

Direct effects of NO or its chemical derivative peroxynitrite on ion channels have also been documented. In particular, Bolotina et al. (3) demonstrated that Ca2+-dependent K+ channels in aortic vascular smooth muscle cells are activated via a direct effect of NO. Although similar large conductance K+ channels in normal rat type I cells are known to be activated by NO via a cGMP-dependent mechanism (22), a study in rabbit carotid body has indicated that NO donors inhibit L-type Ca2+ channels via a chemical modification of channel protein, involving sulfhydryl groups (23). It remains for future studies to determine whether such direct effects of NO on ion channel function are enhanced in type I cells following exposure to CH.

It is well established that CH induces increased chemosensitivity in rat carotid body, which in hypoxia is manifest as both an elevated chemoreceptor discharge (5) and hypoxic ventilatory response (1). Increased NO production following CH suggests the existence of important adaptive control mechanisms that counteract the development of excitatory factors. Moreover, the present data indicate that CH induces major adjustments in cell signaling mechanisms that bypass intermediate regulatory steps, resulting in an abnormally robust inhibitory response. Such changes may indicate conservation of energy in cells maintaining a high level of activity while undergoing continuous hypoxic stress.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institutes of Health Grants NS-12636 and NS-07938.


    FOOTNOTES
 

Address for reprint requests and other correspondence: B. Dinger, Dept. of Physiology, Univ. of Utah School of Medicine, 420 Chipeta Way, Ste. 1700, Salt Lake City, UT 84108-6500 (e-mail: b.dinger{at}utah.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Aaron EA, Powell FL. Effect of chronic hypoxia on hypoxic ventilatory response in awake rats. J Appl Physiol 74: 1635–1640, 1993.[Abstract/Free Full Text]
  2. Alcayaga J, Barrios M, Bustos F, Miranda G, Molina MJ, Iturriaga R. Modulatory effect of nitric oxide on acetylcholine-induced activation of cat petrosal ganglion neurons in vitro. Brain Res 825: 194–198, 1999.[CrossRef][Web of Science][Medline]
  3. Bolotina VM, Najibi S, Paiacino JJ, Pagano PJ, Cohen RA. Nitric oxide directly activates calcium-dependent potassium channels in vascular smooth muscle. Nature 368: 850–853, 1994.[CrossRef][Medline]
  4. Buerk DG, Lahiri S. Evidence that nitric oxide plays a role in O2 sensing from tissue NO and PO2 measurements in cat carotid body. Adv Exp Med Biol 475: 337–347, 2000.[Web of Science][Medline]
  5. Chen J, He L, Dinger B, Stensaas L, Fidone S. Role of endothelin and endothelin A-type receptor in physiological adaptation of the carotid body during chronic hypoxia. Am J Physiol Lung Cell Mol Physiol 282: L1314–L1323, 2002.[Abstract/Free Full Text]
  6. Chinkers M, Garbers DL, Chang MS, Lowe DG, Chin H, Goeddel DV, Schulz S. A membrane form of guanylate cyclase is an atrial natriuretic peptide receptor. Nature 388: 78–83, 1989.
  7. Crawley DE, Zhao L, Giembycz MA, Liu S, Barnes PJ, Winter RJD, Evans TW. Chronic hypoxia impairs soluble guanylyl cyclase-mediated pulmonary arterial relaxation in the rat. Am J Physiol Lung Cell Mol Physiol 263: L325–L332, 1992.[Abstract/Free Full Text]
  8. Di Giulio C, Grilli A, De Lutiis MA, Di NF, Sabatino G, Felaco M. Does chronic hypoxia increase rat carotid body nitric oxide? Comp Biochem Physiol A Mol Integr Physiol 120: 243–247, 1998.[CrossRef][Medline]
  9. Dinger B, Liu X, He L, Stensaas L, Fidone S. Time-course of cytokine expression and immune cell invasion induced in rat carotid body by chronic hypoxia. FASEB J 20: A1256, 2006.[Free Full Text]
  10. Glynos C, Kotanidou A, Orfanos SE, Zhou Z, Simoes DC, Magkou C, Roussos C, Papapetropoulos A. Soluble guanylyl cyclase expression is reduced in LPS-induced lung injury. Am J Physiol Regul Integr Comp Physiol 292: R1448–R1455, 2007.[Abstract/Free Full Text]
  11. Hassoun PM, Filippov G, Fogel M, Donaldson C, Kayyali US, Shimoda LA, Bloch KD. Hypoxia decreases expression of soluble guanylate cyclase in cultured rat pulmonary artery smooth muscle cells. Am J Respir Cell Mol Biol 30: 908–913, 2004.[Abstract/Free Full Text]
  12. He L, Chen J, Dinger B, Stensaas L, Fidone S. Effect of chronic hypoxia on purinergic synaptic transmission in rat carotid body. J Appl Physiol 100: 157–162, 2006.[Abstract/Free Full Text]
  13. He L, Dinger B, Fidone S. Cellular mechanisms involved in carotid body inhibition produced by atrial natriuretic peptide. Am J Physiol Cell Physiol 278: C845–C852, 2000.[Abstract/Free Full Text]
  14. He L, Dinger B, Fidone S. Cellular mechanisms involved in carotid body inhibition produced by atrial natriuretic peptide. Am J Physiol Cell Physiol 278: C845–C852, 2000.[Abstract/Free Full Text]
  15. He L, Dinger B, Fidone S. Effect of chronic hypoxia on cholinergic chemotransmission in rat carotid body. J Appl Physiol 98: 614–619, 2005.[Abstract/Free Full Text]
  16. Iturriaga R, Villanueva S, Mosqueira M. Dual effects of nitric oxide on cat carotid body chemoreception. J Appl Physiol 89: 1005–1012, 2000.[Abstract/Free Full Text]
  17. Kusakabe T, Matsuda H, Harada Y, Hayashida Y, Gono Y, Kawakami T, Takenaka T. Changes in the distribution of nitric oxide synthase immunoreactive nerve fibers in the chronically hypoxic rat carotid body. Brain Res 795: 292–296, 1998.[CrossRef][Web of Science][Medline]
  18. Liu X, He L, Gonzalez C, Cifrese J, Dinger B, Stensaas L, Fidone S. Chronic hypoxia induces immune cell invasion and cytokine expression in rat carotid body (Abstract). Soc Neurosci 635.9, 2005.
  19. Mosqueira M, Iturriaga R. Carotid body chemosensory excitation induced by nitric oxide: involvement of oxidative metabolism. Respir Physiol Neurobiol 131: 175–187, 2002.[CrossRef][Web of Science][Medline]
  20. Prabhakar N, Rao S, Premkumar D, Pieramici SF, Kumar GK, Kalari RK. Regulation of neuronal nitric oxide synthase gene expression by hypoxia: role of nitric oxide in respiratory adaptation to low PO2. Adv Exp Med Biol 410: 345–348, 1996.[Medline]
  21. Sallmann S, Juttler E, Prinz S, Petersen N, Knopf U, Weiser T, Schwaninger M. Induction of interleukin-6 by depolarization of neurons. J Neurosci 20: 8637–8642, 2000.[Abstract/Free Full Text]
  22. Silva JM, Lewis DL. Nitric oxide enhances Ca2+-dependent K+ channel activity in rat carotid body cells. Pflügers Arch 443: 671–675, 2002.[CrossRef][Web of Science][Medline]
  23. Summers BA, Overhold JL, Prabhakar NR. Nitric oxide inhibits L-type Ca2+ current in glomus cells of the rabbit carotid body via a cGMP-independent mechanism. J Neurophysiol 81: 1149–1457, 1999.
  24. Wang ZZ, Dinger BG, Stensaas LJ, Fidone SJ. The role of nitric oxide in carotid chemoreception. Biol Signals 4: 109–116, 1995.[Web of Science][Medline]
  25. Wang ZZ, He L, Stensaas LJ, Dinger BG, Fidone SJ. Localization and in vitro actions of atrial natriuretic peptide in the cat carotid body. J Appl Physiol 70: 942–946, 1991.[Abstract/Free Full Text]
  26. Wang ZZ, Stensaas JJ, Bredt DS, Dinger B, Fidone SJ. Localization and actions of nitric oxide in the cat carotid body. Neurosci 60: 275–286, 1994.[CrossRef][Web of Science][Medline]
  27. Wang ZZ, Stensaas LJ, Bredt DS, Dinger BG, Fidone SJ. Mechanisms of carotid body inhibition. In: Arterial Chemoreceptors, edited by O'Regan RG, Nolan P, McQueen DS, Paterson DJ. Adv Exp Med Biol 360: 229–235, 1994.[Medline]
  28. Wang ZZ, Stensaas LJ, Dinger BG, Fidone SJ. Nitric oxide mediates chemoreceptor inhibition in the cat carotid body. Neurosci 65: 217–229, 1995.[CrossRef][Web of Science][Medline]
  29. Wang ZZ, Stensaas LJ, Wang WJ, Dinger B, de Vente J, Fidone SJ. Atrial natriuretic peptide increases cyclic guanosine monophosphate immunoreactivity in the carotid body. Neurosci 49: 479–486, 1992.[CrossRef][Web of Science][Medline]
  30. Wu BN, Chen CW, Liou SF, Yeh JL, Chung HH, Chen IJ. Inhibition of proinflammatory tumor necrosis factor-{alpha}-induced inducible nitric-oxide synthase by xanthine-based 7-[2-[4-(2-chlorobenzene)piperazinyl]ethyl]-1,3-dimethylxanthine (KMUP-1) and 7-[2-[4-(4-nitrobenzene) piperazinyl]ethyl]-1, 3-dimethylxanthine (KMUP-3) in rat trachea: the involvement of soluble guanylate cyclase and protein kinase G. Mol Pharmacol 70: 977–985, 2006.[Abstract/Free Full Text]
  31. Yamamoto Y, Konig P, Henrich M, Dedio J, Kummer W. Hypoxia induces production of nitric oxide and reactive oxygen species in glomus cells of rat carotid body. Cell Tissue Res 325: 3–11, 2006.[CrossRef][Web of Science][Medline]
  32. Ye JS, Tipoe GL, Fung PCW, Fung ML. Augmentation of hypoxia-induced nitric oxide generation in the rat carotid body adapted to chronic hypoxia: an involvement of constitutive and inducible nitric oxide synthases. Pflügers Arch 444: 178–185, 2002.[CrossRef][Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/6/L1463    most recent
00249.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via ISI Web of Science (2)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, L.
Right arrow Articles by Fidone, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, L.
Right arrow Articles by Fidone, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.