AJP - Lung Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 294: L214-L224, 2008. First published November 30, 2007; doi:10.1152/ajplung.00086.2007
1040-0605/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/2/L214    most recent
00086.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haley, K. J.
Right arrow Articles by Lilly, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haley, K. J.
Right arrow Articles by Lilly, C. M.

Ontogeny of the eotaxins in human lung

Kathleen J. Haley,1 Mary E. Sunday,2,4 Yolanda Porrata,1 Colleen Kelley,1 Anne Twomey,3 Aliakbar Shahsafaei,2 Benjamin Galper,1 Larry A. Sonna,5 and Craig M. Lilly1

1Department of Medicine, Brigham and Women's Hospital, and 2Department of Pathology, Brigham and Women's and Children's Hospitals, Boston, Massachusetts; 3Department of Medicine, National Maternity Hospital, Dublin, Ireland; 4Departments of Pathology and Medicine, Duke University, Durham, North Carolina; 5Division of Pulmonary and Critical Care Medicine, University of Maryland School of Medicine, Baltimore, Maryland

Submitted 7 March 2007 ; accepted in final form 20 November 2007


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The ontogeny of the C-C chemokines eotaxin-1, eotaxin-2, and eotaxin-3 has not been fully elucidated in human lung. We explored a possible role for eotaxin in developing lung by determining the ontogeny of eotaxin-1 (CCL11), eotaxin-2 (CCL24), eotaxin-3 (CCL26), and the eotaxin receptor, CCR3. We tested discarded surgical samples of developing human lung tissue using quantitative RT-PCR (QRT-PCR) and immunostaining for expression of CCL11, CCL24, CCL26, and CCR3. We assessed possible functionality of the eotaxin-CCR3 system by treating lung explant cultures with exogenous CCL11 and analyzing the cultures for evidence of changes in proliferation and activation of ERK1/2, a signaling pathway associated with CCR3. QRT-PCR analyses of 22 developing lung tissue samples with gestational ages 10–23 wk demonstrated that eotaxin-1 mRNA is most abundant in developing lung, whereas mRNAs for eotaxin-2 and eotaxin-3 are minimally detectable. CCL11 mRNA levels correlated with gestational age (P < 0.05), and immunoreactivity was localized predominantly to airway epithelial cells. QRT-PCR analysis detected CCR3 expression in 16 of 19 developing lung samples. Supporting functional capacity in the immature lung, CCL11 treatment of lung explant cultures resulted in significantly increased (P < 0.05) cell proliferation and activation of the ERK signaling pathway, which is downstream from CCR3, suggesting that proliferation was due to activation of CCR3 receptors by CCL11. We conclude that developing lung expresses the eotaxins and functional CCR3 receptor. CCL11 may promote airway epithelial proliferation in the developing lung.

pulmonary development; embryonic; epithelium


THE EOTAXINS ARE MEMBERS of the macrophage chemoattractant protein/eotaxin chemokines, a small subfamily of C-C chemokines. Three eotaxins have been identified, eotaxin-1/CCL11 (CCL11) (53), eotaxin-2/CCL24 (CCL24) (13), and eotaxin-3/CCL26 (CCL26) (31), all of which activate the C-C chemokine receptor-3 (CCR3) (11, 15, 30) and share several functions, such as eosinophil chemoattraction and activation (30, 31, 42, 57, 62). The eotaxins are associated with allergic diseases (18, 25, 29, 34, 35, 44, 45, 53, 5759, 62, 69, 72, 74, 75) and are increased in atopic dermatitis (5, 24), allergic conjunctivitis (37), asthma (35, 38, 41, 76), and nasal polyposis (4, 61). Additionally, these chemokines are increased in nonallergic syndromes characterized by eosinophilic tissue infiltrates, such as inflammatory bowel disease (6, 16, 28, 36, 46) and bullous pemphigoid (1, 14, 20, 67).

In contrast to diseases associated with eosinophilia, the role of the eotaxins in processes where eosinophils are rare or absent has not been fully elucidated. Recent studies indicate that the eotaxins have significant roles in noneosinophilic inflammatory processes. For example, CCL11 is chemoattractant for basophils (71) and can act as a colony-stimulating factor for myeloid cells (52). Eotaxin expression is present in cell cultures of T lymphocytes (18). CCL11 modulates the secretion of interferon-{gamma} from T helper type 1 (Th1) T cells in a model of murine pulmonary granuloma formation (60) and has been implicated in the pathophysiology of vascular inflammation in rats (7) and in humans (22). Cumulatively, these observations suggest that eotaxins have a biological role beyond the recruitment of eosinophils and allergic inflammatory cells.

One possible such role is promoting the differentiation of the normal human lung. It is unknown whether the eotaxins are expressed or functional in normal developing human lung, an environment typically containing few, if any, eosinophils. We tested the hypothesis that eotaxin is present and active during human lung development. First, we determined the ontogeny of CCL11, CCL24, CCL26, and their receptor, CCR3, in developing lung. Our observation that the eotaxins are present in developing human lung where eosinophils are rarely appreciated caused us to ask whether the eotaxin-CCR3 receptor-ligand system has effects on developing human airways that might not be easily appreciated in animal models. We therefore investigated the possible functionality of the eotaxin-CCR3 receptor-ligand system in the immature lung by testing the responsiveness of these tissues to exogenous CCL11 in human lung explant cultures. Our findings indicate that explant cultures respond to CCL11 with increased indices of proliferation and activation of ERK1/2. Thus our study demonstrates a possible function for the eotaxin/CCR3 system in the developing human lung.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Study protocol. The Brigham and Women's Hospital's Human Research Committee reviewed and approved the study protocol, and each subject gave written informed consent for use of discarded surgical material and completion of a questionnaire regarding past medical and family history.

RNA extraction and analysis (RT-PCR and qPCR). Total RNA was prepared from 29 first and second trimester (gestational age 10–23 wk) lung tissue samples obtained from discarded surgical specimens and processed for histological and RNA analyses as previously described (23). RNA (1 µg) from 21 of these samples was treated with DNase (Invitrogen, Carlsbad, CA) following manufacturer's instructions before reverse transcription. Reverse transcription to cDNA was performed using the RETROscript reverse transcription kit (Ambion, Austin, TX), following the manufacturer's instructions. RT-PCR analysis was performed on the resulting cDNAs as previously described, using primer pairs yielding products spanning at least one intron (23). CCL11 primer sequences (Integrated DNA Technologies, Coralville, IA) were sense acaccttcagcctccaacat and antisense cacagctttctggggacatt, and cyclophilin primers (Gene Link, Hawthorne, NY) were sense aggtcccaaagacagcagaa and antisense tgtccacagtcagcaatggt. The PCR products were analyzed using ethidium bromide-stained 2% agarose gels; only samples yielding a robust band for cyclophilin on the ethidium gel were studied in subsequent quantitative PCR experiments.

We used TaqMan Universal Master Mix (Applied Biosystems, Foster City, CA) and validated (2) TaqMan gene expression assay primer/probe combinations for CCL11 (assay ID Hs 00237013_m1), CCL24 (assay ID Hs 00171082_m1), CCL26 (assay ID Hs 00171146_m1), CCR3 (assay ID Hs 00266213_s1), and the endogenous control 18S (cat. no. 4333760T) following manufacturer's instructions for real-time quantitative PCR (qPCR) analyses. Except for CCR3, the PCR products all spanned at least one intron. The CCR3 analysis used cDNA prepared from DNase-treated RNA. All qPCR results were normalized to the expression of the endogenous positive control 18S. Comparison of the expression levels of the mRNA encoding CCL11 among the lung tissues samples used the expression of CCL11 normalized to that of the endogenous control, 18S, as previously reported (70). Comparisons of the expression levels of the mRNAs encoding CCL11, CCL24, and CCL26 were performed using the {Delta}{Delta}Ct cycle threshold method among developing lung samples that had been tested for expression of all three eotaxins.

Histological and immunohistochemical analyses. Hematoxylin and eosin (H&E) stains and immunostaining using an avidin-biotin technique were performed in 36 samples with gestational ages between 10–23 wk as previously described (22, 23). Primary antisera included murine anti-CCL11 (dilution 1:50, gift of P. Ponath), rabbit anti-phosphorylated ERK1/2 (dilution 1:50; Cell Signaling, Beverly, MA), murine anti-PCNA (clone PC10, dilution 1:75; Dako Cytomation, Carpinteria, CA), rabbit anti-vimentin (dilution 1:250; Abcam), and rabbit anti-cytokeratin (dilution 1:1,000; Dako Cytomation). Pretreatments with heat antigen retrieval (ERK1/2), methanol (PCNA), and trypsin (cytokeratin) were used as needed. Substitution of primary antibodies with irrelevant murine and rabbit IgG (Sigma Chemical, St. Louis, MO) were the negative controls. Immunostaining results were assessed as previously described (22, 23).

Double stains were used to confirm colocalization of specific cell type markers. For the eotaxin and cytokeratin staining, eotaxin staining was performed as outlined above. Then, slides were treated with trypsin, and a murine cytokeratin at 1:500 (Sigma Chemical) was applied for 1 h at room temperature. Following washing, donkey anti-mouse secondary antibody labeled with alkaline phosphatase (DM-AP; Jackson ImmunoResearch Laboratories, West Grove, PA) at 1:500 was applied for one-half hour at room temperature, and the antibody was visualized using Dako Permanent Red (Dako Cytomation) according to the manufacturer's instructions. Eotaxin immunostaining was identified by brown color, and cytokeratin by red. For the PCNA and cytokeratin staining, murine anti-PCNA (Dako Cytomation) was applied for 1 h at room temperature to slides following incubation with methanol. Following washing, DM-AP was applied, and the antibody visualized using Dako Permanent Red as outlined above. The slides were treated with trypsin followed by rabbit anti-cytokeratin at 1:1,000 (Dako Cytomation). Following washing, goat anti-rabbit biotinylated secondary antibody at 1:200 (Vector Laboratories, Burlingame, CA) was applied for one-half hour at room temperature, endogenous peroxidases were blocked using ethanol (Fisher Chemical) with 1.5% hydrogen peroxide (Thermo Fisher Scientific, Waltham, MA) at room temperature for 15 min, and the antibody was visualized using Vector SG (Vector Laboratories) according to the manufacturer's instructions. PCNA immunostaining was identified by red staining, cytokeratin by gray-blue, and colocalization of PCNA and cytokeratin in the same cellular area by purple. Double staining for ERK1/2 and cytokeratin was performed as above for ERK1/2 using a 1:25 dilution followed by DM-AP at room temperature for 30 min and visualized using Dako Permanent Red (Dako Cytomation). Slides were then treated with trypsin, and murine anti-cytokeratin 1:750 (Sigma Chemical) was applied for 1 h at room temperature, followed by biotinylated horse anti-mouse at 1:200 (Vector Laboratories) and visualized as above with Vector SG (Vector Laboratories). ERK1/2 immunostaining was identified by red staining, cytokeratin by gray-blue, and colocalization of ERK1/2 and cytokeratin in the same cellular area by purple.

Organ explant culture. Organ explant cultures were prepared and maintained for 5 days as previously described (64) from three lung tissue samples with gestational ages 17, 21, and 23 wk obtained from discarded surgical samples. Each lung tissue sample was divided into three explant cultures. CCL11 (PeproTech, Rocky Hill, NJ) was added daily to the cultures in doses of 0, 12, and 120 nM, which encompassed the range of eotaxin concentrations previously reported (52, 55). The explant culture samples were harvested after 5 days of culture, fixed in 4% paraformaldehyde, routinely processed, and embedded in paraffin for histological analyses, including immunostaining for PCNA and ERK1/2, as outlined below.

Statistical analyses. Statistical analyses of qPCR and immunostaining results used ANOVA on ranks. Comparison of the presence or absence of CCL11 immunostaining used {chi}2 analysis. Correlations between CCL11 mRNA expression and ERK1/2 immunostaining with gestational age and questionnaire results were assessed using linear regression analysis. Effects of CCL11 treatment of explants were analyzed by two-way ANOVA. For all analyses, differences were considered significant if P < 0.05.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Ontogeny of the eotaxins. Sixty-five lung tissue samples from developing lung were obtained and processed for RNA (n = 29) and histology (n = 36) studies. Of these, four samples were processed for both RNA and histological analyses.

We first determined whether any of the eotaxins could be detected in normal developing human lung. Since previous investigators had demonstrated greater abundance of CCL11 compared with other eotaxins (12, 56, 74), we reasoned that it was likely that CCL11 would be the most readily identified member of the eotaxins and so focused these initial studies on this chemokine. Whole lung RNA was prepared, and cDNA was made from 29 lung tissue samples having gestational ages between 10–23 wk. The samples were then analyzed by RT-PCR analysis for expression of the endogenous control gene cyclophilin (49): 25 of 29 samples expressed cyclophilin (Fig. 1A). Using primers designed to span at least 1 intron, which permits discrimination between cDNA derived from mRNA and contaminating genomic DNA, a PCR product of the expected base pair size (206) for the mRNA encoding CCL11 was demonstrated in 22 of the 25 samples expressing cyclophilin (Fig. 1A).


Figure 1
View larger version (35K):
[in this window]
[in a new window]

 
Fig. 1. A: ethidium bromide-stained gel of RT-PCR analysis demonstrating expression of the mRNA encoding CCL11 in samples of developing human lung with gestational ages 10–22 wk. The endogenous control mRNA for cyclophilin is presented to show equal loading among the samples. No band was identified in the negative control (No RT) lane. GA, gestational age; Pos, positive control (cDNA prepared from A549 cells treated with interleukin-1β, which has been shown to induce CCL11 expression in these cells; Ref. 39). B: quantitative PCR analysis demonstrating expression of the mRNA encoding CCL11 normalized to expression of the endogenous control 18S in developing human lung. C: quantitative PCR analysis demonstrating increased expression of the mRNA encoding eotaxin correlated significantly (P < 0.05) with increasing gestational age.

 
Next, we examined the quantitative expression of the eotaxins among the 22 developing human lung samples identified as expressing CCL11 mRNA by RT-PCR by subjecting them to real-time qPCR (Fig. 1B). The expression of the endogenous control 18S was used to normalize the expression of the mRNA for each primer. The majority of the samples were analyzed for expression of all three eotaxins (CCL11, CCL24, and CCL26) and CCR3. However, due to the limited amount of study material available for some samples, a few were only analyzed for CCL11 and eotaxin-2 CCL24 expression. The qPCR analysis demonstrated significant differences in the amount of CCL11 mRNA expression among the samples (P < 0.05), and linear regression analysis showed a significant correlation between CCL11 mRNA expression and increasing gestational age (P < 0.05; Fig. 1C). Since the sample with gestational age 13 wk had much lower eotaxin-1 mRNA expression than the other samples with gestational ages less than 15 wk, the analysis was repeated omitting this sample. This second analysis confirmed a strong trend toward increased CCL11 mRNA expression with increased gestational age, with P = 0.055. Analyzing the expression of CCL11 by trimester confirmed significantly greater (P < 0.05) mRNA expression in the samples from the second trimester (n = 20) compared with the first trimester samples (n = 3). Additionally, there was a trend toward a direct correlation between CCL11 expression and a family history of asthma and/or atopy. The maternal questionnaires for 13 of the 23 samples and 6 of the 7 of the samples with the highest levels of CCL11 mRNA expression had positive responses to queries about health professional-diagnosed asthma and/or atopy symptoms.

qPCR also detected the mRNA encoding CCL24 in 11 of 22 and CCL26 in 13 of 21 developing lung tissue samples. All of the samples analyzed by qPCR demonstrated abundant expression of the mRNA encoding 18S. There was a trend for more abundant CCL26 mRNA in samples less than 19 wk gestational age in that 7 of 7 samples between gestational ages 10–18 wk expressed the mRNA encoding CCL26, but only 6 of 14 samples with gestational age greater than 18 wk did. Expression levels among CCL11, CCL24, and CCL26 were compared using the {Delta}{Delta}Ct method (2). ANOVA on ranks comparing the {Delta}{Delta}Ct values in 13 lung tissue samples that had qPCR analyses for all 3 eotaxins showed that CCL11 mRNA had greater abundance than either CCL11 or CCL26 in lung tissue samples at all gestational ages tested and that this difference was significantly greater for both CCL24 (P < 0.05) and CCL26 (P < 0.05) in our samples of gestational age of at least 15 wk (n = 10; Fig. 2).


Figure 2
View larger version (18K):
[in this window]
[in a new window]

 
Fig. 2. Comparison of the expression of CCL11, CCL24, and CCL26 in developing human lung using quantitative PCR analysis. Box plot showing median and 25–75% quartile expression levels of the mRNAs encoding CCL11, CCL24, and CCL26 normalized to 18S expression is reported for lung samples from both the 1st (n = 3) and 2nd (n = 10) trimester. The 10th and 90th percentile ranges are indicated by dots below and above the ranges for the 2nd trimester samples. For comparison, the stage of lung development (pseudoglandular from gestational age 5–15 wk and canalicular starting at gestational age 16 wk) corresponding to the gestational ages is provided below the graph.

 
Although eotaxin is thought to be transcriptionally regulated (39), the immature lung does not make protein for all expressed mRNAs (68). We therefore used immunohistochemical analysis to assess whether the developing human lung expresses eotaxin protein. We focused these studies on immunostaining for CCL11 because this eotaxin consistently demonstrated the greatest abundance of mRNA in our samples. Immunostaining performed in 36 paraffin-embedded lung tissue samples detected CCL11 protein in 17 out of 36 samples of developing human lung with gestational ages between 11–23 wk (Fig. 3, a and b). The majority of the immunopositive cells colocalized with cytokeratin, identifying them as epithelial cells (Fig. 3, c and d). Specificity was demonstrated by substituting the primary antibody with an irrelevant IgG, which ablated the immunostaining (Fig. 3, e and f). The likelihood of immunostaining was significantly greater in samples with a gestational age less than 20 wk: 16 out of 23 samples with gestational ages between 11–19 wk demonstrated immunopositive cells, whereas 3 out of 13 samples with gestational ages at least 20 wk demonstrated immunopositive cells (P < 0.05). This is in contrast to the mRNA expression, which demonstrated a direct correlation with gestational age. Since CCL11 is known to be a chemoattractant for eosinophils, we tested for evidence of eosinophilic infiltrates in our developing lung tissue samples by examining H&E-stained sections. Despite protein and mRNA expression of the eotaxins, H&E staining did not detect tissue eosinophils in any sample, with a minimum of 10 high-power fields examined per sample.


Figure 3
View larger version (123K):
[in this window]
[in a new window]

 
Fig. 3. Immunostaining demonstrating expression of eotaxin protein in human lung in both the pseudoglandular and canalicular stages of development. a: Immunostaining for CCL11 in developing lung with gestational age 12 wk. Magnification, x200. b: Immunostaining for CCL11 in developing lung with gestational age 21.5 wk. Magnification, x200. c: Immunostaining in developing lung with gestational age 16 wk with brown staining indicating cells immunopositive for CCL11. Magnification, x200. d: Same tissue section shown in c, immunostained for cytokeratin, an epithelial cell marker, with red indicating cells immunopositive for cytokeratin. Magnification, x200. Inset shows detail of colocalization of the 2 chromagens, consistent with expression of CCL11 by epithelial cells. Magnification, x1,000. e: Immunostaining for CCL11 in developing human lung with gestational age 16 wk. Magnification, x200. f: Substitution of the primary antibody with irrelevant IgG in the same sample shown in e demonstrates ablation of immunostaining. Magnification, x200.

 
Ontogeny of CCR3. We examined the expression of the eotaxin receptor, CCR3, by using qPCR to compare the abundance of mRNA encoding CCR3 to that of 18S. All of the RNA samples used for this assay were treated with DNase before being subjected to reverse transcription since the primer set used for this analysis did not span an intron. All of the samples expressed abundant 18S by qPCR following DNase treatment. The mRNA encoding CCR3 was detected in 16 of 19 samples of developing human lung with gestational ages between 10–23 wk. Samples of 21.5 wk gestation and older had low levels of CCR3 mRNA detected. All samples that expressed the mRNA encoding CCR3 also expressed the mRNA for CCL11 (Fig. 4).


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 4. Expression of eotaxin receptor CCR3 in developing human lung. Quantitative PCR analysis of the mRNA encoding CCR3, normalized to 18S expression. Sixteen of nineteen samples of developing human lung tissue with gestational ages 10–22 wk demonstrated expression of CCR3 mRNA; all samples expressing CCR3 had also expressed CCL11.

 
Functional capacity of eotaxin in developing lung. We examined the functional consequences of CCR3 ligation by CCL11 in a model of human lung development. We measured the effects of exogenous CCL11 on cell proliferation in fetal lung tissue explant tissue culture. Cell proliferation was assessed by immunostaining for PCNA. Explant cultures prepared from 3 samples of developing lung tissue with gestational ages 17, 21, and 23 wk were each treated with 0 (controls), 12 nM, and 120 nM CCL11. Since the half-life of eotaxin in culture is ~2 h (3), the cultures were treated with eotaxin every day. Two-way ANOVA demonstrated that the effects of eotaxin depended on both the concentration of eotaxin, with the maximal effects noted at 12 nM, and the gestational age of the sample, with little to no increase in proliferation noted in cultures from the 23 wk-gestation lung (P < 0.05). ANOVA on ranks showed significantly (P < 0.05) increased tissue area percent positive for PCNA after CCL11 treatment in the cultures prepared from the 17- and 21-wk lung samples (Fig. 5, A and B, b1 and b2, and Table 1). Colocalization with well-characterized cell type markers for epithelial cells (cytokeratin) demonstrated PCNA-positive cells in the cytokeratin-expressing cells (Fig. 5B, b3–b6). The abundant PCNA immunostaining in keratin-expressing cells is consistent with epithelial proliferation following CCL11 treatment.


Figure 5
View larger version (70K):
[in this window]
[in a new window]

 
Fig. 5. Effects of exogenous CCL11 on organ explant cultures prepared from 3 developing lung tissue samples with gestational ages 17, 21, and 23 wk, each culture subdivided into 3 and treated with 0, 12, and 120 nM CCL11. A: box plot demonstrating median, 25–75% interquartile range, and 95% confidence intervals following CCL11 treatment. Area percent of occupied by cells immunopositive for PCNA was used to assess the effects of CCL11 treatment on the explant cultures. Bars indicate 95% confidence intervals. B, b1: PCNA immunostaining in untreated explant culture prepared from 17-wk developing lung. Magnification, x200. b2: PCNA immunostaining in explant culture prepared from 17-wk developing lung and treated with 12 nM eotaxin daily for 5 days. Magnification, x200. b3–b6: Immunostaining in 23-wk developing lung treated with 120 nM CCL11 for 5 days showing cells immunopositive (b3, red) for PCNA, a proliferation marker, in the same area as cells immunopositive (b4, gray-blue) for cytokeratin, an epithelial cell marker. Colocalization confirmed by double staining for PCNA and cytokeratin shown in b5. Magnification, x200. b6: High power detail of double stain shown in b5 with straight arrows indicating cells staining only for cytokeratin and curved arrows indicating cells double-stained for PCNA and cytokeratin. Magnification, x1,000.

 

View this table:
[in this window]
[in a new window]

 
Table 1. Increased proliferation following treatment of lung tissue explant cultures with exogenous CCL11

 
Signaling cascade activation following eotaxin-1 treatment of organ explant cultures. Signaling transduced by CCR3 can involve activation of ERK1/2 (10, 29), a member of the MAPK signaling cascade. We compared the abundance of the activated (phosphorylated) form of ERK1/2 in the explant cultures as a function of treatment with CCL11 using a specific antibody. ANOVA on ranks showed that the percentage of area that was positive for ERK1/2 staining was significantly greater after treatment with CCL11 [Fig. 6, a and b; P < 0.05; 3.6 (2.5–96)-fold increase after 12 nM CCL11, 1.5 (0.09–14) after 120 nM CCL11, median fold increase and interquartile range]. Representative ERK1/2 immunostaining for untreated explant culture is shown in Fig. 6c and for explant culture treated with CCL11 in Fig. 6d.


Figure 6
View larger version (63K):
[in this window]
[in a new window]

 
Fig. 6. ERK activation in CCL11-treated organ explant cultures. a: Box plot showing median, 25–75% interquartile range, and 95% confidence interval for area percent ERK1/2 immunopositivity following 5-day treatment with CCL11 at 0, 12, and 120 nM. Black dots indicate 95% confidence intervals. Area percent ERK1/2 immunostaining increased significantly (*P < 0.05) following 12 nM CCL11 treatment compared with untreated cultures. b: Effects of CCL11 greatest at 12 nM, as shown by box plot demonstrating fold increase in ERK1/2 immunostaining. Plot shows median, 25–75% interquartile range, and 95% confidence intervals (black dots). Fold increase in area percent ERK1/2 immunostaining significantly increased (**P < 0.001) compared with untreated cultures for both 12 and 120 nM CCL11. c: Representative immunostaining for phosphorylated ERK1/2 in untreated explant culture prepared from 17-wk developing lung. Magnification, x200. d: Representative immunostaining for phosphorylated ERK1/2 in 12 nM CCL11-treated explant culture prepared from 17-wk developing lung, demonstrating significantly increased (P < 0.05) abundance of immunopositive cells compared with untreated culture. e: Representative immunostaining for phosphorylated ERK1/2 in developing human lung tissue sample with gestational age 21.5 wk. Magnification, x100. f: No immunostaining was detected in same area of the lung tissue sample shown in e following substitution of the primary antisera with irrelevant IgG. Magnification, x100. gj: Colocalization of ERK1/2 immunostaining with cytokeratin, an epithelial marker in developing human lung. g: ERK1/2 immunostaining (red) in 22-wk developing human lung. Magnification, x200. h: cytokeratin immunostaining (blue-gray) in a serial section of 22-wk developing human lung. Magnification, x200. i: Serial section in 22-wk developing human lung confirming colocalization of ERK1/2 and cytokeratin immunostaining confirmed with double stain. Magnification, x200. j: High power detail of double stain shown in i, demonstrating epithelial cells immunopositive for only cytokeratin (arrows) and double stained for ERK1/2 and cytokeratin (curved arrows). Magnification, x1,000.

 
To test for possible affects of the lung explant culture process itself on the expression and activation of ERK1/2, we also analyzed the expression of phosphorylated ERK1/2 in paraffin-embedded developing lung tissue samples with gestational ages between 10–23 wk. We randomly selected 12 of the 17 samples that had demonstrated immunopositivity for CCL11 and tested them for expression of ERK1/2. Immunostaining demonstrated ERK1/2 in all of these samples (Fig. 6e). No immunostaining was appreciated following substitution of the primary antisera by an irrelevant IgG (Fig. 6f). Immunopositivity for ERK1/2 was abundant in cells expressing the epithelial marker cytokeratin (Fig. 6, g and h). Colocalization of ERK1/2 and cytokeratin was confirmed using double staining (Fig. 6, i and j).

Immunostaining for ERK1/2 in fetal lung tissue culture treated with CCL11 primarily localized to the airway epithelium and mesenchymal substructures where proliferation was also seen (Fig. 7, a and b), consistent with activation of ERK1/2 in the same cell types demonstrating increased proliferation following CCL11 treatment. The ERK1/2 immunostaining in the lung tissue samples predominantly colocalized with cytokeratin immunostaining (Fig. 7, df), consistent with epithelial cell expression. Thus the epithelium was the site of the most abundant CCL11 expression in the lung tissue samples, the greatest amount of proliferation following CCL11 treatment in developing lung explant cultures, and showed immunopositivity for the activated form of one of the signaling cascades associated with CCL11 responses (Fig. 7, af).


Figure 7
View larger version (88K):
[in this window]
[in a new window]

 
Fig. 7. Epithelial cells have the greatest abundance of CCL11 immunostaining in developing human lung and show the majority of the proliferative response and ERK1/2 activation following CCL11 treatment in developing lung explant cultures. ac: Representative immunostaining (arrows) in organ explant cultures prepared from 17-wk developing human lung treated with 120 nM eotaxin-1 showing PCNA staining (a) colocalizing with phosphorylated ERK1/2 (b) and cytokeratin (c). df: Representative immunostaining (arrows) in 21.5-wk developing human lung showing CCL11 expression (d) colocalizing with phosphorylated ERK (e) and cytokeratin (f). Magnification, x200. V, vessel.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study demonstrates that developing human lung expresses the mRNA for CCL11, CCL24, CCL26, and CCR3. Additionally, our study shows that the immature human lung expresses the protein for CCL11. Whereas the eotaxins were detected in our samples, eosinophils were not detected in the developing lung tissue samples used in these studies. Thus our study extends previous investigations demonstrating functioning of the eotaxin/CCR3 system in processes without significant eosinophilia to the developing human lung. The absence of eosinophils despite expression of CCL11 and CCR3 has previously been reported in studies of vascular inflammation (7, 22) and suggests that this receptor-ligand system has a function other than the recruitment of eosinophils in developing lung.

We defined the spatial and temporal expression of CCL11 and the temporal expression of CCL24, CCL26, and CCR3 in developing human lung. In our samples, the abundance of CCL11 directly correlated with both gestational age and a family history of atopy and/or asthma. This suggests that the developing human lung regulates the expression of eotaxin, a necessary precondition for a functional role during lung development. Additionally, the trend toward a correlation of increased CCL11 expression with a maternal history of atopic disease suggests that some mediator abnormalities associated with asthma and atopy may predate the environmental exposures that are thought to drive eotaxin expression. Our findings support the speculation that activation of CCR3 during lung development could be permissive for postnatal lung disease.

The majority of the cells expressing CCL11 protein were airway epithelial cells, which are a major source of eotaxin in adult lung (9, 33, 39, 56, 76). Thus the mRNA for all the eotaxins and the eotaxin receptor are present in most normal human lung samples from both the first and second trimesters, which are important periods of growth and maturation for the developing lung. This differs from normal adult human lung. Although the mRNAs encoding CCL11 and CCL24 can be detected in normal human adult lung (17, 35, 74), the amount of protein appears to be minimal, with little to no detection by Western analysis (74), immunostaining (38, 74), or ELISA (65). In contrast, our data indicate that CCL11 protein can be detected in most samples of normal developing human lung. Our finding that CCR3 is constitutively expressed at low levels in the developing lung are similar to those reported for normal adult human lung (51, 76).

The coexpression of CCR3 and CCL11 suggests a functional role for the receptor-ligand system. In support of this hypothesis, we demonstrated that CCL11 treatment of lung tissue cultures increased PCNA-positive cells, together with phosphorylated ERK1/2, both of which were present predominantly in the epithelium. In fact, most of the PCNA-positive cells also expressed phosphorylated ERK1/2, consistent with activation of ERK1/2 in these cells. These findings indicate that midtrimester human fetal lung can respond to CCL11 by increasing proliferation and can activate an eotaxin-associated signaling cascade (ERK1/2). Limited tissue availability prevented us from performing blocking experiments that would have conclusively demonstrated that the exogenous CCL11 activated ERK1/2 in the explant cultures.

The present functional analysis was focused on changes in proliferation as a general indicator of responsiveness to CCL11, which, in the developing lung, is frequently inversely correlated with the expression of differentiation markers (63). Lungs of gestational age greater than 21 wk expressed low levels of CCR3 and were less responsive to treatment with CCL11. Cumulatively, these observations suggest that CCL11 activates CCR3 receptors on the epithelium of the developing lung in a manner that facilitates expansion and may modulate airway development. Since the range of CCL11 concentrations used in the lung tissue culture studies included 100 nM, affects at either CCR5 or CCR2 cannot be excluded from the present studies (50). However, since the maximal effects on proliferation were seen at 10 nM CCL11, it is likely that the proliferation effects observed in our culture studies were due to CCR3 activation.

This role for the eotaxin/CCR3 system is consistent with the role that another cytokine, TNF-{alpha}, plays in the developing lung. TNF-{alpha} is constitutively expressed in embryonic murine lung (32), and TNF-{alpha} treatment of murine lung bud cultures increases branching morphogenesis (27). Similar to the findings in mice deficient in one or more eotaxins (54, 59, 73), TNF-{alpha} is not critical for lung development since TNF-{alpha} null mice have unremarkable adult baseline pulmonary histology (43).

Our study expands to the lung prior investigations regarding the roles of the eotaxins in development. CCL11 has also been shown to modulate the development of other organ systems, such as the murine mammary gland, where this chemokine is required for normal branch development (19). Additionally, CCL11 modulates murine fetal hematopoiesis, including the development of myeloid precursors and mast cells (55).

Previous investigations examining the overexpression of CCL11 in mice focused on the effects of overexpression in the adult lung either transiently (47, 48) or selectively in the type II cells (47). Neither pattern of CCL11 overexpression altered lung histology, although the effects of the transgene on bronchiolar epithelial cells, a major site of eotaxin expression in our study, were not detailed in these studies.

Characterization of neither CCL11-deficient mice (59, 73) nor CCL11- and CCL24-deficient mice (54) showed a baseline lung abnormality. However, the eotaxins have largely overlapping actions (6, 8, 13, 31, 33, 37, 44, 69, 74), and our study demonstrates that the immature lung expresses all three eotaxins during development. It is possible that increased expression of either CCL24 or CCL26 might have obscured the effects of CCL11 or the combined CCL11 and CCL24 deficiency. Alternatively, whereas the eotaxins may not be required for normal pulmonary organogenesis, they could nonetheless contribute to the regulation of lung development. Such functional redundancy is observed with multiple growth factors that stimulate growth and maturation of developing fetal lung (21, 43, 66). Our data support a functional role for the eotaxins in human lung development.

Deficiency of CCR3 has also been examined in the mouse model (26). These mice demonstrate increased airway responsiveness to methacholine challenge compared with wild-type animals following intraperitoneal ovalbumin sensitization and aerosolized challenge. This study did not examine the effects of CCR3 deficiency on the epithelium in detail. Our study shows that this receptor-ligand system can support proliferation of the epithelium of the developing human lung.

In conclusion, this study demonstrates that CCL11 and its receptor, CCR3, are expressed by developing human lung, an environment containing few if any eosinophils. In vitro studies with organ cultures demonstrate increased cell proliferation following CCL11 treatment and activation of an eotaxin-associated signaling cascade, consistent with functionality of this system in these cells. Cumulatively, our observations support the hypothesis that CCL11 activates the CCR3 receptor on developing lung epithelial cells to facilitate their proliferation and growth. Thus our data support the postulate that the eotaxin-CCR3 receptor-ligand system has a role in human lung development that is distinct from its established role in inflammatory cell recruitment.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was funded by National Institutes of Health Award 5K08HL067910 (K. J. Haley).


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. J. Haley, Brigham and Women's Hospital, Division of Pulmonary and Critical Care Medicine, PBB-3, 75 Francis St., Boston, MA 02115 (e-mail: khaley{at}rics.bwh.harvard.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Amerio P, Frezzolini A, Feliciani C, Verdolini R, Teofoli P, De Pita O, Puddu P. Eotaxins and CCR3 receptor in inflammatory and allergic skin diseases: therapeutical implications. Curr Drug Targets Inflamm Allergy 2: 81–94, 2003.[CrossRef][Medline]
  2. Applied Biosystems. Guide to performing relative quantitation of gene expression using real-time quantitatve PCR. In: Part Number 4371095 Rev A, 2004.
  3. Atasoy U, Curry SL, Lopez de Silanes I, Shyu AB, Casolaro V, Gorospe M, Stellato C. Regulation of eotaxin gene expression by TNF-alpha and IL-4 through mRNA stabilization: involvement of the RNA-binding protein HuR. J Immunol 171: 4369–4378, 2003.[Abstract/Free Full Text]
  4. Bachert C, Gevaert P, Holtappels G, van Cauwenberge P. Mediators in nasal polyposis. Curr Allergy Asthma Rep 2: 481–487, 2002.[Medline]
  5. Bartels J, Schluter C, Richter E, Noso N, Kulke R, Christophers E, Schroder JM. Human dermal fibroblasts express eotaxin: molecular cloning, mRNA expression, and identification of eotaxin sequence variants. Biochem Biophys Res Commun 225: 1045–1051, 1996.[CrossRef][Web of Science][Medline]
  6. Blanchard C, Durual S, Estienne M, Emami S, Vasseur S, Cuber JC. Eotaxin-3/CCL26 gene expression in intestinal epithelial cells is up-regulated by interleukin-4 and interleukin-13 via the signal transducer and activator of transcription 6. Int J Biochem Cell Biol 37: 2559–2573, 2005.[CrossRef][Medline]
  7. Chen J, Akyurek LM, Fellstrom B, Hayry P, Paul LC. Eotaxin and capping protein in experimental vasculopathy. Am J Pathol 153: 81–90, 1998.[Abstract/Free Full Text]
  8. Chou DL, Daugherty BL, McKenna EK, Hsu WM, Tyler NK, Plopper CG, Hyde DM, Schelegle ES, Gershwin LJ, Miller LA. Chronic aeroallergen during infancy enhances eotaxin-3 expression in airway epithelium and nerves. Am J Respir Cell Mol Biol 33: 1–8, 2005.[Abstract/Free Full Text]
  9. Cook EB, Stahl JL, Lilly CM, Haley KJ, Sanchez H, Luster AD, Graziano FM, Rothenberg ME. Epithelial cells are a major cellular source of the chemokine eotaxin in the guinea pig lung. Allergy Asthma Proc 19: 15–22, 1998.[CrossRef][Medline]
  10. Cui CH, Adachi T, Oyamada H, Kamada Y, Kuwasaki T, Yamada Y, Saito N, Kayaba H, Chihara J. The role of mitogen-activated protein kinases in eotaxin-induced cytokine production from bronchial epithelial cells. Am J Respir Cell Mol Biol 27: 329–335, 2002.[Abstract/Free Full Text]
  11. Daugherty BL, Siciliano SJ, DeMartino JA, Malkowitz L, Sirotina A, Springer MS. Cloning, expression, and characterization of the human eosinophil eotaxin receptor. J Exp Med 183: 2349–2354, 1996.[Abstract/Free Full Text]
  12. Dulkys Y, Schramm G, Kimmig D, Knoss S, Weyergraf A, Kapp A, Elsner J. Detection of mRNA for eotaxin-2 and eotaxin-3 in human dermal fibroblasts and their distinct activation profile on human eosinophils. J Invest Dermatol 116: 498–505, 2001.[CrossRef][Medline]
  13. Forssmann U, Uguccioni M, Loetscher P, Dahinden CA, Langen H, Thelen M, Baggiolini M. Eotaxin-2, a novel CC chemokine that is selective for the chemokine receptor CCR3, and acts like eotaxin on human eosinophil and basophil leukocytes. J Exp Med 185: 2171–2176, 1997.[Abstract/Free Full Text]
  14. Frezzolini A, Teofoli P, Cianchini G, Barduagni S, Ruffelli M, Ferranti G, Puddu P, De Pita O. Increased expression of eotaxin and its specific receptor CCR3 in bullous pemphigoid. Eur J Dermatol 12: 27–31, 2002.[Web of Science][Medline]
  15. Gao JL, Sen AI, Kitaura M, Yoshie O, Rothenberg ME, Murphy PM, Luster AD. Identification of a mouse eosinophil receptor for the CC chemokine eotaxin. Biochem Biophys Res Commun 223: 679–684, 1996.[CrossRef][Web of Science][Medline]
  16. Garcia-Zepeda EA, Rothenberg ME, Ownbey RT, Celestin J, Leder P, Luster AD. Human eotaxin is a specific chemoattractant for eosinophil cells and provides a new mechanism to explain tissue eosinophilia. Nat Med 2: 449–456, 1996.[CrossRef][Web of Science][Medline]
  17. Ghaffar O, Hamid Q, Renzi PM, Allakhverdi Z, Molet S, Hogg JC, Shore SA, Luster AD, Lamkhioued B. Constitutive and cytokine-stimulated expression of eotaxin by human airway smooth muscle cells. Am J Respir Crit Care Med 159: 1933–1942, 1999.[Abstract/Free Full Text]
  18. Gonzalo JA, Jia GQ, Aguirre V, Friend D, Coyle AJ, Jenkins NA, Lin GS, Katz H, Lichtman A, Copeland N, Kopf M, Gutierrez-Ramos JC. Mouse eotaxin expression parallels eosinophil accumulation during lung allergic inflammation but it is not restricted to a Th2-type response. Immunity 4: 1–14, 1996.[Medline]
  19. Gouon-Evans V, Rothenberg ME, Pollard JW. Postnatal mammary gland development requires macrophages and eosinophils. Development 127: 2269–2282, 2000.[Abstract]
  20. Gunther C, Wozel G, Dressler J, Meurer M, Pfeiffer C. Tissue eosinophilia in pemphigoid gestationis: association with eotaxin and upregulated activation markers on transmigrated eosinophils. Am J Reprod Immunol 51: 32–39, 2004.[Medline]
  21. Guo L, Degenstein L, Fuchs E. Keratinocyte growth factor is required for hair development but not for wound healing. Genes Dev 10: 165–175, 1996.[Abstract/Free Full Text]
  22. Haley KJ, Lilly CM, Yang JH, Feng Y, Kennedy SP, Turi TG, Thompson JF, Sukhova GH, Libby P, Lee RT. Overexpression of eotaxin and the CCR3 receptor in human atherosclerosis: using genomic technology to identify a potential novel pathway of vascular inflammation. Circulation 102: 2185–2189, 2000.[Abstract/Free Full Text]
  23. Haley KJ, Sunday ME, Osathanondh R, Du J, Vathanaprida C, Karpitsky VV, Krause JE, Lilly CM. Developmental expression of neurokinin A and functional neurokinin-2 receptors in lung. Am J Physiol Lung Cell Mol Physiol 280: L1348–L1358, 2001.[Abstract/Free Full Text]
  24. Huber MA, Denk A, Peter RU, Weber L, Kraut N, Wirth T. The IKK-2/Ikappa Balpha /NF-kappa B pathway plays a key role in the regulation of CCR3 and eotaxin-1 in fibroblasts. A critical link to dermatitis in Ikappa Balpha-deficient mice. J Biol Chem 277: 1268–1275, 2002.[Abstract/Free Full Text]
  25. Humbles AA, Conroy DM, Marleau S, Rnakin SM, Palframan RT, Prouldfoot AE, Wells TN, Li D, Jeffery PK, Griffiths-Johnson DA, Williams TJ, Jose PJ. Kinetics of eotaxin generation and its relationship to eosinophil accumulation in allergic airways disease: analysis in a guinea pig model in vivo. J Exp Med 186: 601–612, 1997.[Abstract/Free Full Text]
  26. Humbles AA, Lu B, Friend DS, Okinaga S, Lora J, Al-garawi A, Martin TR, Gerard NP, Gerard C. The murine CCR3 receptor regulates both the role of eosinophils and mast cells in allergen-induced airway inflammation and hyperresponsiveness. Proc Natl Acad Sci USA 99: 1479–1484, 2002.[Abstract/Free Full Text]
  27. Jaskoll T, Boyer PD, Melnick M. Tumor necrosis factor-alpha and embryonic mouse lung morphogenesis. Dev Dyn 201: 137–150, 1994.[Web of Science][Medline]
  28. Jeziorska M, Haboubi N, Schofield P, Woolley DE. Distribution and activation of eosinophils in inflammatory bowel disease using an improved immunohistochemical technique. J Pathol 194: 484–492, 2001.[Medline]
  29. Kampen GT, Stafford S, Adachi T, Jinquan T, Quan S, Grant JA, Skov PS, Poulsen LK, Alam R. Eotaxin induces degranulation and chemotaxis of eosinophils through the activation of ERK2 and p38 mitogen-activated protein kinases. Blood 95: 1911–1917, 2000.[Abstract/Free Full Text]
  30. Kitaura M, Nakajima T, Imai T, Harada S, Combadiere C, Tiffany HL, Murphy PM, Yoshie O. Molecular cloning of human eotaxin, an eosinophil-selective CC chemokine, and identification of a specific eosinophil eotaxin receptor, CC chemokine receptor 3. J Biol Chem 271: 7725–7730, 1996.[Abstract/Free Full Text]
  31. Kitaura M, Suzuki N, Imai T, Takagi S, Suzuki R, Nakajima T, Hirai K, Nomiyama H, Yoshie O. Molecular cloning of a novel human CC chemokine (Eotaxin-3) that is a functional ligand of CC chemokine receptor 3. J Biol Chem 274: 27975–27980, 1999.[Abstract/Free Full Text]
  32. Kohchi C, Noguchi K, Tanabe Y, Mizuno D, Soma G. Constitutive expression of TNF-alpha and -beta genes in mouse embryo: roles of cytokines as regulator and effector on development. Int J Biochem 26: 111–119, 1994.[CrossRef][Web of Science][Medline]
  33. Komiya A, Nagase H, Yamada H, Sekiya T, Yamaguchi M, Sano Y, Hanai N, Furuya A, Ohta K, Matsushima K, Yoshie O, Yamamoto K, Hirai K. Concerted expression of eotaxin-1, eotaxin-2, and eotaxin-3 in human bronchial epithelial cells. Cell Immunol 225: 91–100, 2003.[CrossRef][Web of Science][Medline]
  34. Kraneveld AD, Folkerts G, Van Oosterhout AJ, Nijkamp FP. Airway hyperresponsiveness: first eosinophils and then neuropeptides. Int J Immunopharmacol 19: 517–527, 1997.[CrossRef][Web of Science][Medline]
  35. Lamkhioued B, Renzi PM, Abi-Younes S, Garcia-Zepada EA, Allakhverdi Z, Ghaffar O, Rothenberg MD, Luster AD, Hamid Q. Increased expression of eotaxin in bronchoalveolar lavage and airways of asthmatics contributes to the chemotaxis of eosinophils to the site of inflammation. J Immunol 159: 4593–4601, 1997.[Abstract]
  36. Lampinen M, Carlson M, Hakansson LD, Venge P. Cytokine-regulated accumulation of eosinophils in inflammatory disease. Allergy 59: 793–805, 2004.[CrossRef][Web of Science][Medline]
  37. Leonardi A, Jose PJ, Zhan H, Calder VL. Tear and mucus eotaxin-1 and eotaxin-2 in allergic keratoconjunctivitis. Ophthalmology 110: 487–492, 2003.[CrossRef][Web of Science][Medline]
  38. Lilly CM, Nakamura H, Belostotsky OI, Haley KJ, Garcia-Zepeda EA, Luster AD, Israel E. Eotaxin expression after segmental allergen challenge in subjects with atopic asthma. Am J Respir Crit Care Med 163: 1669–1675, 2001.[Abstract/Free Full Text]
  39. Lilly CM, Nakamura H, Kesselman H, Nagler-Anderson C, Asano K, Garcia-Zepeda EA, Rothenberg ME, Drazen JM, Luster AD. Expression of eotaxin by human lung epithelial cells: induction by cytokines and inhibition by glucocorticoids. J Clin Invest 99: 1767–1773, 1997.[Web of Science][Medline]
  40. Lilly CM, Woodruff PG, Camargo CA Jr, Nakamura H, Drazen JM, Nadel ES, Hanrahan JP. Elevated plasma eotaxin levels in patients with acute asthma. J Allergy Clin Immunol 104: 786–790, 1999.[CrossRef][Web of Science][Medline]
  41. Luster AD, Rothenberg ME. Role of the monocyte chemoattractant protein and eotaxin subfamily of chemokines in allergic inflammation. J Leukoc Biol 62: 620–633, 1997.[Abstract]
  42. Marino MW, Dunn A, Grail D, Inglese M, Noguchi Y, Richards E, Jungbluth A, Wada H, Moore M, Williamson B, Basu S, Old LJ. Characterization of tumor necrosis factor-deficient mice. Proc Natl Acad Sci USA 94: 8093–8098, 1997.[Abstract/Free Full Text]
  43. Menzies-Gow A, Ying S, Sabroe I, Stubbs VL, Soler D, Williams TJ, Kay AB. Eotaxin (CCL11) and eotaxin-2 (CCL24) induce recruitment of eosinophils, basophils, neutrophils, and macrophages as well as features of early- and late-phase allergic reactions following cutaneous injection in human atopic and nonatopic volunteers. J Immunol 169: 2712–2718, 2002.[Abstract/Free Full Text]
  44. Minshall EM, Cameron L, Lavigne F, Leung DY, Hamilos D, Garcia-Zepada EA, Rothenberg M, Luster AD, Hamid Q. Eotaxin mRNA and protein expression in chronic sinusitis and allergen-induced nasal responses in seasonal allergic rhinitis. Am J Respir Cell Mol Biol 17: 683–690, 1997.[Abstract/Free Full Text]
  45. Mir A, Minguez M, Tatay J, Pascual I, Pena A, Sanchiz V, Almela P, Mora F, Benages A. Elevated serum eotaxin levels in patients with inflammatory bowel disease. Am J Gastroenterol 97: 1452–1457, 2002.[CrossRef][Medline]
  46. Mishra A, Weaver TE, Beck DC, Rothenberg ME. Interleukin-5-mediated allergic airway inflammation inhibits the human surfactant protein C promoter in transgenic mice. J Biol Chem 276: 8453–8459, 2001.[Abstract/Free Full Text]
  47. Mould AW, Ramsay AJ, Matthaei KI, Young IG, Rothenberg ME, Foster PS. The effect of IL-5 and eotaxin expression in the lung on eosinophil trafficking and degranulation and the induction of bronchial hyperreactivity. J Immunol 164: 2142–2150, 2000.[Abstract/Free Full Text]
  48. Nakamura H, Weiss ST, Israel E, Luster AD, Drazen JM, Lilly CM. Eotaxin and impaired lung function in asthma. Am J Respir Crit Care Med 160: 1952–1956, 1999.[Abstract/Free Full Text]
  49. Ogilvie P, Bardi G, Clark-Lewis I, Baggiolini M, Uguccioni M. Eotaxin is a natural antagonist for CCR2 and an agonist for CCR5. Blood 97: 1920–1924, 2001.[Abstract/Free Full Text]
  50. Oyamada H, Kamada Y, Kuwasaki T, Yamada Y, Kobayashi Y, Cui C, Honda K, Kayaba H, Saito N, Chihara J. CCR3 mRNA expression in bronchial epithelial cells and various cells in allergic inflammation. Int Arch Allergy Immunol 120, Suppl 1: 45–47, 1999.
  51. Peled A, Gonzalo JA, Lloyd C, Gutierrez-Ramos JC. The chemotactic cytokine eotaxin acts as a granulocyte- macrophage colony-stimulating factor during lung inflammation. Blood 91: 1909–1916, 1998.[Abstract/Free Full Text]
  52. Ponath PD, Qin S, Ringler DJ, Clark-Lewis I, Wang J, Kassam N, Smith H, Shi X, Gonzalo JA, Newman W, Gutierrez-Ramos JC, Mackay CR. Cloning of the human eosinophil chemoattractant, eotaxin. Expression, receptor binding, and functional properties suggest a mechanism for the selective recruitment of eosinophils. J Clin Invest 97: 604–612, 1996.[Web of Science][Medline]
  53. Pope SM, Zimmermann N, Stringer KF, Karow ML, Rothenberg ME. The eotaxin chemokines and CCR3 are fundamental regulators of allergen-induced pulmonary eosinophilia. J Immunol 175: 5341–5350, 2005.[Abstract/Free Full Text]
  54. Quackenbush EJ, Wershil BK, Aguirre V, Gutierrez-Ramos JC. Eotaxin modulates myelopoiesis and mast cell development from embryonic hematopoietic progenitors. Blood 92: 1887–1897, 1998.[Abstract/Free Full Text]
  55. Ravensberg AJ, Ricciardolo FL, van Schadewijk A, Rabe KF, Sterk PJ, Hiemstra PS, Mauad T. Eotaxin-2 and eotaxin-3 expression is associated with persistent eosinophilic bronchial inflammation in patients with asthma after allergen challenge. J Allergy Clin Immunol 115: 779–785, 2005.[CrossRef][Medline]
  56. Rothenberg ME. Eotaxin. An essential mediator of eosinophil trafficking into mucosal tissues. Am J Respir Cell Mol Biol 21: 291–295, 1999.[Free Full Text]
  57. Rothenberg ME, Luster AD, Lilly CM, Drazen JM, Leder P. Constitutive and allergen-induced expression of eotaxin mRNA in the guinea pig lung. J Exp Med 181: 1211–1216, 1995.[Abstract/Free Full Text]
  58. Rothenberg ME, MacLean JA, Pearlman E, Luster AD, Leder P. Targeted disruption of the chemokine eotaxin partially reduces antigen-induced tissue eosinophilia. J Exp Med 185: 785–790, 1997.[Abstract/Free Full Text]
  59. Ruth JH, Lukacs NW, Warmington KS, Polak TJ, Burdick M, Kunkel SL, Strieter RM, Chensue SW. Expression and participation of eotaxin during mycobacterial (type 1) and schistosomal (type 2) antigen-elicited granuloma formation. J Immunol 161: 4276–4282, 1998.[Abstract/Free Full Text]
  60. Seto H, Suzaki H, Shioda S. Immunohistochemical localization of eotaxin immunoreactivity in nasal polyps. Acta Otolaryngol Suppl: 99–104, 2004.
  61. Shahabuddin S, Ponath P, Schleimer RP. Migration of eosinophils across endothelial cell monolayers: interactions among IL-5, endothelial-activating cytokines, and C-C chemokines. J Immunol 164: 3847–3854, 2000.[Abstract/Free Full Text]
  62. Sunday ME, Hua J, Dai HB, Nusrat A, Torday JS. Bombesin increases fetal lung growth and maturation in utero and in organ culture. Am J Respir Cell Mol Biol 3: 199–205, 1990.[Web of Science][Medline]
  63. Sunday ME, Hua J, Reyes B, Masui H, Torday JS. Anti-bombesin monoclonal antibodies modulate fetal mouse lung growth and maturation in utero and in organ cultures. Anat Rec 236: 25–32, 1993.[CrossRef][Medline]
  64. van Wetering S, Zuyderduyn S, Ninaber DK, van Sterkenburg MA, Rabe KF, Hiemstra PS. Epithelial differentiation is a determinant in the production of eotaxin-2 and -3 by bronchial epithelial cells in response to IL-4 and IL-13. Mol Immunol 44: 803–811, 2007.[CrossRef][Web of Science][Medline]
  65. Wada E, Watase K, Yamada K, Ogura H, Yamano M, Inomata Y, Eguchi J, Yamamoto K, Sunday ME, Maeno H, Mikoshiba K, Ohki-Hamazaki H, Wada K. Generation and characterization of mice lacking gastrin-releasing peptide receptor. Biochem Biophys Res Commun 239: 28–33, 1997.[CrossRef][Web of Science][Medline]
  66. Wakugawa M, Nakamura K, Hino H, Toyama K, Hattori N, Okochi H, Yamada H, Hirai K, Tamaki K, Furue M. Elevated levels of eotaxin and interleukin-5 in blister fluid of bullous pemphigoid: correlation with tissue eosinophilia. Br J Dermatol 143: 112–116, 2000.[CrossRef][Medline]
  67. Wert SE, Glasser SW, Korfhagen TR, Whitsett JA. Transcriptional elements from the human SP-C gene direct expression in the primordial respiratory epithelium of transgenic mice. Dev Biol 156: 426–443, 1993.[CrossRef][Web of Science][Medline]
  68. White JR, Imburgia C, Dul E, Appelbaum E, O'Donnell K, O'Shannessy DJ, Brawner M, Fornwald J, Adamou J, Elshourbagy NA, Kaiser K, Foley JJ, Schmidt DB, Johanson K, Macphee C, Moores K, McNulty D, Scott GF, Schleimer RP, Sarau HM. Cloning and functional characterization of a novel human CC chemokine that binds to the CCR3 receptor and activates human eosinophils. J Leukoc Biol 62: 667–675, 1997.[Abstract]
  69. Xu J, Tian J, Grumelli SM, Haley KJ, Shapiro SD. Stage-specific effects of cAMP signaling during distal lung epithelial development. J Biol Chem 281: 38894–38904, 2006.[Abstract/Free Full Text]
  70. Yamada H, Hirai K, Miyamasu M, Iikura M, Misaki Y, Shoji S, Takaishi T, Kasahara T, Morita Y, Ito K. Eotaxin is a potent chemotaxin for human basophils. Biochem Biophys Res Commun 231: 365–368, 1997.[CrossRef][Web of Science][Medline]
  71. Yamada H, Yamaguchi M, Yamamoto K, Nakajima T, Hirai K, Morita Y, Sano Y. Eotaxin in induced sputum of asthmatics: relationship with eosinophils and eosinophil cationic protein in sputum. Allergy 55: 392–397, 2000.[CrossRef][Web of Science][Medline]
  72. Yang Y, Loy J, Ryseck RP, Carrasco D, Bravo R. Antigen-induced eosinophilic lung inflammation develops in mice deficient in chemokine eotaxin. Blood 92: 3912–3923, 1998.[Abstract/Free Full Text]
  73. Ying S, Meng Q, Zeibecoglou K, Robinson DS, Macfarlane A, Humbert M, Kay AB. Eosinophil chemotactic chemokines (eotaxin, eotaxin-2, RANTES, monocyte chemoattractant protein-3 (MCP-3), and MCP-4), and C-C chemokine receptor 3 expression in bronchial biopsies from atopic and nonatopic (Intrinsic) asthmatics. J Immunol 163: 6321–6329, 1999.[Abstract/Free Full Text]
  74. Ying S, Robinson DS, Meng Q, Barata LT, McEuen AR, Buckley MG, Walls AF, Askenase PW, Kay AB. C-C chemokines in allergen-induced late-phase cutaneous responses in atopic subjects: association of eotaxin with early 6-hour eosinophils, and of eotaxin-2 and monocyte chemoattractant protein-4 with the later 24-hour tissue eosinophilia, and relationship to basophils and other C-C chemokines (monocyte chemoattractant protein-3 and RANTES). J Immunol 163: 3976–3984, 1999.[Abstract/Free Full Text]
  75. Ying S, Robinson DS, Meng Q, Rottman J, Kennedy R, Ringler DJ, Mackay CR, Daugherty BL, Springer MS, Durham SR, Williams TJ, Kay AB. Enhanced expression of eotaxin and CCR3 mRNA and protein in atopic asthma. Association with airway hyperresponsiveness and predominant co-localization of eotaxin mRNA to bronchial epithelial and endothelial cells. Eur J Immunol 27: 3507–3516, 1997.[Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/2/L214    most recent
00086.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haley, K. J.
Right arrow Articles by Lilly, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haley, K. J.
Right arrow Articles by Lilly, C. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.