AJP - Lung Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Lung Cell Mol Physiol 294: L225-L232, 2008. First published December 7, 2007; doi:10.1152/ajplung.00370.2007
1040-0605/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/2/L225    most recent
00370.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, H.-S.
Right arrow Articles by Sanchez-Esteban, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, H.-S.
Right arrow Articles by Sanchez-Esteban, J.

Interleukin-10 protects cultured fetal rat type II epithelial cells from injury induced by mechanical stretch

Hyeon-Soo Lee, Yulian Wang, Benjamin S. Maciejewski, Kenny Esho, Christiaan Fulton, Surendra Sharma, and Juan Sanchez-Esteban

Department of Pediatrics, Women and Infants Hospital of Rhode Island and the Warren Alpert Medical School of Brown University, Providence, Rhode Island

Submitted 7 September 2007 ; accepted in final form 4 December 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mechanical ventilation plays a central role in the pathogenesis of bronchopulmonary dysplasia. However, the mechanisms by which excessive stretch of fetal or neonatal type II epithelial cells contributes to lung injury are not well defined. In these investigations, isolated embryonic day 19 fetal rat type II epithelial cells were cultured on substrates coated with fibronectin and exposed to 5% or 20% cyclic stretch to simulate mechanical forces during lung development or lung injury, respectively. Twenty percent stretch of fetal type II epithelial cells increased necrosis, apoptosis, and proliferation compared with control, unstretched samples. By ELISA and real-time PCR (qRT-PCR), 20% stretch increased secretion of IL-8 into the media and IL-8 gene expression and inhibited IL-10 release. Interestingly, administration of recombinant IL-10 before 20% stretch did not affect cell lysis but significantly reduced apoptosis and IL-8 release compared with stretched samples without IL-10. Collectively, our studies suggest that IL-10 may play an important role in protection of fetal type II epithelial cells from injury secondary to stretch.

fetal type II epithelial cells; interleukin-8


MECHANICAL FORCES GENERATED in utero by repetitive breathing movements and by fluid distension are essential to mammalian lung development (12, 16, 21). Paradoxically, many premature infants born with underdeveloped lungs are exposed to excessive, non-physiological levels of stretch. This may result in ventilator-induced lung injury, which plays an important role in the pathogenesis of bronchopulmonary dysplasia (BPD), a chronic inflammatory lung disease with serious short- and long-term morbidities (10). Excessive stretch of the lung by mechanical ventilation can disrupt the integrity of the alveolar-capillary barrier, resulting in interstitial and alveolar edema. Neutrophils and macrophages recruited to the lung can then trigger and amplify an injury response by releasing cytokines and other inflammatory mediators (40).

Several proinflammatory cytokines and chemokines such as TNF-{alpha}, IL-1β, IL-6, IL-18, MIP-2, and MCP-1, etc., have been shown to be increased in the lung after injury. IL-8 is probably one of the most important chemotactic factors during the acute phase of lung inflammation (25). IL-8 is secreted by alveolar macrophages, fibroblasts, type II pneumocytes, and endothelial cells (41). In contrast, IL-10 is a cytokine with potent anti-inflammatory properties due to its ability to decrease synthesis and secretion of inflammatory cytokines (28). IL-10 appears to be a key temporal regulator of normal gestational length, and its unscheduled premature withdrawal at the maternal-fetal interface is associated with preterm labor and birth (9, 22, 26). IL-10 also protects the host from systemic inflammation after toxin-induced injury (17). In the lung, low IL-10 concentrations have been found in the bronchoalveolar lavage of patients with BPD (14, 27, 37). It has been postulated that the increased levels of proinflammatory cytokines present in the lung of infants with BPD may reflect the inability to regulate inflammation through low expression of IL-10 (11).

Type II epithelial cells are key components of the alveolar structure. Not only do they secrete surfactant, but they also participate in fluid homeostasis in the alveolar lumen, host defense, and restoration of normal alveolar epithelium after lung injury (30). Physiological mechanical stimulation of alveolar type II cells is important for surfactant secretion (49) and surfactant protein gene expression (31). However, alveolar type II epithelial cells can also be exposed to overstretch and therefore to injury secondary to mechanical ventilation. Previous in vitro studies in adult rat type II epithelial cells have demonstrated that excessive stretch can induce apoptosis (6, 7) and cell membrane stress failure (46) resulting in cell death (43). In addition, cyclic stretch of adult type II cells can also promote inflammation by stimulating IL-8 (47, 50) and MCP-1 (8). However, since BPD normally occurs in premature infants, it is important to investigate how underdeveloped lungs respond to mechanical injury.

Therefore, the objective of these studies was to evaluate the response of fetal type II epithelial cells to injury secondary to stretch. We hypothesized that fetal type II epithelial cells contribute to lung inflammation by creating an imbalance between pro- and anti-inflammatory cytokines. We further speculated that IL-10 administration would protect type II cells from injury secondary to excessive stretch. We used an in vitro model system in which rat fetal type II cells isolated on embryonic day 19 (E19) of gestation (transition from canalicular to saccular stages of lung development) were exposed to stretch to simulate mechanical forces during lung development or lung injury. Our studies revealed that excessive stretch of fetal type II cells induced necrosis, apoptosis, proliferation, and inflammation. IL-10 administration protected fetal type II cells from injury mediated by stretch.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell isolation and stretch protocol. Animal experiments were approved by the Lifespan Institutional Animal Care and Use Committee. Fetal rat lungs were obtained from timed-pregnant Sprague-Dawley rats (Charles River, Wilmington, MA), and E19 type II cells were isolated as previously described (34). Briefly, after collagenase digestion, cell suspensions were sequentially filtered through 100-, 30-, and 20-µm nylon meshes using screen cups (Sigma). The filtrate from the 20-µm nylon mesh, containing mostly fibroblasts, was discarded. Clumped nonfiltered cells from the 30- and 20-µm nylon meshes were collected after several washes with DMEM to facilitate the filtration of nonepithelial cells. Further type II cell purification was achieved by incubating the cells in 75-cm2 flasks for 30 min. Nonadherent cells were collected and cultured overnight in 75-cm2 flasks containing serum-free DMEM. The purity of the type II cell fraction was determined to be 90 ± 5% by microscopic analysis of epithelial cell morphology and immunostaining for cytokeratin/surfactant protein C and vimentin as markers of epithelial cells and fibroblasts, respectively (35). After overnight culture, type II epithelial cells were harvested with 0.25% (wt/vol) trypsin in 0.4 mM EDTA and plated at a density of 10 x 105 cells/well on Bioflex multiwell plates (Flexcell International, Hillsborough, NC) precoated with fibronectin (1.5 µg/cm2). Plates containing adherent cells were maintained for an additional 24 h in serum-free DMEM and then were mounted in a Flexcell FX-4000 Strain Unit (Flexcell International). Equibiaxial stretch of 5% or 20% was applied at intervals of 40 cycles/min for 6 h or 24 h. Cells grown on nonstretched membranes were treated in an identical manner and served as controls.

Lactate dehydrogenase assay. Lactate dehydrogenase (LDH) activity was measured using a CytoTox 96 non-radioactive cytotoxicity assay (Promega) according to the manufacturer's protocol. This assay measures LDH release into the supernatant upon cell lysis. LDH was analyzed with a coupled enzymatic assay that results in the conversion of a tetrazolium salt into a red formazan product. The amount of color formed is proportional to the number of lysed cells. Absorbance at wavelength 490 nm was collected using a standard 96-well plate reader (ELX800, Bio-Tek Instruments). LDH was quantified by dividing experimental LDH release by maximum LDH release (calculated after complete lysis of monolayers containing similar number of cells to the samples. This value was used as a common denominator for all the samples tested).

TUNEL assay. Detection and quantification of apoptotic cells was performed by use of TUNEL by a fluorescein label apoptosis detection system (Promega, Madison, WI) as previously described in detail (33). Briefly, after experimental conditions, E19 monolayers were fixed in freshly prepared 4% paraformaldehyde in PBS for 25 min at 4°C and permeabilized by immersion in 2.0% Triton X-100 in PBS. Positive controls were cells treated with DNase I to induce DNA fragmentation. Monolayers were incubated at 37°C for 60 min in equilibration buffer, 2-deoxynucleotide 5'-triphosphate, and TdT enzyme as per the manufacturer's protocol. A further control was prepared by omitting the TdT enzyme. Samples were washed in PBS, mounted with Vectashield mounting medium with propidium iodide (Vector Laboratories), and analyzed by fluorescence microscopy. For quantification of apoptotic cells, 50 high-power fields per sample were analyzed. Areas from each membrane quadrant were randomly chosen and photographed. Cells containing green fluorescence and either nuclear condensation or chromatin fragmentation (without nuclear morphological changes) were identified as apoptotic cells. Results were expressed as TUNEL-positive index (number of TUNEL-positive cells per number of total cells).

Western blot analysis of caspase-3. E19 type II cells were exposed to 20% stretch for 24 h. Unstretched samples were used as controls. Monolayers were lysed with RIPA buffer containing protease inhibitors (34). Lysates were centrifuged, and total protein contents were determined by the bicinchoninic acid method. Equal amount of protein lysate samples (20 µg) were fractionated by NU-PAGE Bis-Tris (4–12%) gel electrophoresis (Novex, San Diego, CA) and transferred to polyvinylidene difluoride membranes. Blots were hybridized with polyclonal antibody against the 17/19-kDa cleaved caspase-3 (Cell Signaling Technology, Beverly, MA) to detect activated caspase-3. Secondary antibody was conjugated with horseradish peroxidase; blot was developed with an enhanced chemiluminescence (ECL) detection assay (Amersham Pharmacia Biotech, Piscataway, NJ). Membranes were then stripped and reprobed with antibodies to full-length caspase-3 (Santa Cruz Biotechnology, Santa Cruz, CA) and actin and processed as described before. The intensity of the bands was analyzed by densitometry.

Type II cell proliferation assay. Measurements of cell proliferation were analyzed by DNA incorporation of the thymidine analog 5-bromo-2'-deoxyuridine (BrdU) as described by the manufacturer (Boehringer Mannheim). Briefly, cultures (~60% confluence) were maintained in the mechanically active conditions or not, and immediately before each experiment, fresh medium containing 10 µM BrdU labeling reagent was added to each well. At the end of each experiment, monolayers were washed with PBS and then fixed in 100% methanol for 20 min at –20°C. Cells were then washed and incubated with anti-BrdU antibody (negative controls were incubated with PBS) followed by incubation with fluorescein-conjugated secondary antibody and mounted with Vectashield mounting medium with DAPI (Vector Laboratories). Slides were examined, photographed, and counted under an Olympus bright-field fluorescence microscope. For quantification of BrdU-positive cells, 50 high-power fields per sample were analyzed.

Concentration of cytokines in the supernatant. After experiments, cell culture medium was collected and stored at –80°C before analysis. Cytokine concentration in the supernatant was measured using commercial ELISA kits according to the manufacturer's recommendations (TNF-{alpha}: Quantikine, R&D Systems, Minneapolis, MN, cat. no. RTA00; IL-8: Assay Designs, Ann Arbor, MI, cat. no. 900-074; IL-10: Bio-Plex Cytokine Assay, Bio-Rad Laboratories, Hercules, CA, cat. no. 171-K11070). The optical density was determined photometrically at 450 nm using the ELISA plate reader ELX800 (Bio-Tek Instruments). The ELISA kits have a minimum detectable concentration of 5 pg/ml for TNF-{alpha}, 7.75 pg/ml for IL-8, and 4.91 pg/ml for IL-10. Cytokine levels were within the assay's detection limit in all samples.

Real-time PCR (qRT-PCR). Total RNA was extracted from E19 type II cells exposed to 20% stretch for 24 h or parallel unstretched samples by a single-step method, as previously described (32), and purified further with the RNeasy Mini Kit (Invitrogen). Standard curves were generated for each primer set and housekeeping gene 18S ribosomal RNA. Linear regression revealed efficiencies between 96 and 99%. Therefore, fold expressions of stretched samples relative to controls were calculated using the {Delta}{Delta}CT method for relative quantification (RQ) as previously described (48). Samples were normalized to the 18S rRNA. No differences in RQ values for 18S were found between control and strain samples. TaqMan primers were purchased from Assays-on-Demand gene expression products (Applied Biosystems). The following primers were used: TNF-{alpha} (cat. no.: Rn99999017_m1), GROCINC-1 (rat equivalent of IL-8) (5' primer: CATTAATATTTAACGATGTGGATGCGTTTCA; 3' primer: GCCTACCATCTTTAAACTGCACAAT), IL-10 (cat. no.: Rn99999012_m1) and 18S (cat. no.: Hs99999901_s1). Five micrograms of total RNA was reverse-transcribed into cDNA by the Superscript Double Stranded cDNA Synthesis Kit (Invitrogen). To amplify the cDNA by qRT-PCR, 5 µl of the resulting cDNA were added to a mixture of 25 µl of TaqMan Universal PCR Master Mix (Applied Biosystems) and 2.5 µl of 20x Assays-on-Demand Gene Expression Assay Mix containing forward and reverse primers and TaqMan-labeled probe (Applied Biosystems). The reactions were performed in an ABI Prism 7000 Sequence Detection System (Applied Biosystems). All assays were performed in triplicate.

Statistical analysis. Results are expressed as means ± SE from at least three experiments, using different litters for each experiment. For qRT-PCR and caspase-3 experiments, stretched samples were compared with controls by unpaired Student's t-test. For multiple-group comparisons, data were analyzed with ANOVA followed by post hoc tests. P < 0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Effect of stretch on fetal type II cell cytotoxicity. Previous studies have found that too much stretch of adult type II cells can damage the cell membrane leading to cell death (7, 23). Therefore, we first investigated whether a "physiological" level of stretch (5%) or a more injurious magnitude of stretch (20%) can induce lysis in fetal cells. Isolated E19 type II cells were exposed to 5% or 20% stretch for 6 h or 24 h; cell lysis was analyzed by LDH release into the supernatant. These studies revealed that 5% or 20% stretch for 6 h increased LDH release into the supernatant by 29% or 46%. After 24 h, LDH release increased by 39% (0.50 ± 0.05) or 55.5% (0.56 ± 0.08) after 5% or 20% stretch, respectively, compared with unstretched samples (0.36 ± 1.18) (Fig. 1).


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
Fig. 1. Effect of stretch on type II cell cytotoxicity. Embryonic day 19 (E19) type II cells were exposed to 5% or 20% stretch for 6 h or 24 h. Cell lysis was assayed by lactate dehydrogenase (LDH) released into the supernatant. Results are expressed as experimental minus background LDH release divided by maximum LDH release. Results are means ± SE from 4 different experiments.

 
Overstretch of fetal type II epithelial cells induces apoptosis. Cell death can also be mediated via apoptosis (6, 7). Thus, we studied next whether different stretch protocols promote apoptosis. Isolated fetal type II epithelial cells were exposed to 5% or 20% stretch for 6 h or 24 h. Apoptosis was assessed by TUNEL assay. Five percent stretch for 24 h increased apoptosis 2.5-fold, although it was not statistically significant. In contrast, 20% stretch for either 6 h or 24 h significantly increased the number of TUNEL-positive cells 10-fold (control = 3.58 ± 0.18, stretch = 34.37 ± 4.96) and 9-fold (control = 6.63 ± 0.21, stretch = 59 ± 6.96), respectively, compared with unstretched samples (Fig. 2A). These data suggest that apoptosis depends on the magnitude of stretch. Representative E19 TUNEL fluorescence photomicrographs are shown in Fig. 2B. Cleaved caspase-3, a key executioner protein in apoptosis, was also markedly increased (8-fold) after 20% stretch for 24 h (0.78 ± 0.05 vs. 6.17 ± 0.93) compared with unstretched samples (Fig. 2C), supporting our TUNEL assay results.


Figure 2
View larger version (47K):
[in this window]
[in a new window]

 
Fig. 2. Stretch induces apoptosis.A: E19 type II cells were exposed to stretch protocols for the indicated periods of time. Unstretched samples were used as controls. Detection and quantification of DNA fragmentation was performed by TUNEL assay. Results are means ± SE from 3 different experiments. B: representative fluorescence immunocytochemistry images showing that stretch-induced apoptosis is elongation-dependent. Apoptotic cells are stained green/yellow (arrows). Nuclear, mitochondrial DNA and ribosomal RNA are counterstained with propidium iodide (red). Scale bar = 100 µm. C: Western blot demonstrating that exposure of E19 cells to 20% stretch for 24 h increases the levels of active (cleaved) caspase-3 and concomitantly decreases the abundance of full-length procaspase-3 compared with controls. Membranes were immunoblotted with an anti-cleaved caspase-3 antibody, stripped, and reprobed with full-length procaspase-3 antibody and with actin antibody to control for protein loading (top, representative blots). Data at the bottom are from 3 independent experiments.

 
Stretch stimulates fetal type II cell proliferation. Next, we analyzed the effect of stretch on type II cell proliferation. After 6 h of cyclic stretch, neither 5% nor 20% stretch significantly stimulated type II cell proliferation. In contrast, 20% stretch for 24 h increased BrdU incorporation twofold compared with nonstretched samples (6.4 ± 0.29 vs. 15.4 ± 2.4) (Fig. 3A). Representative fluorescence immunocytochemistry fields from fetal lung type II epithelial cells exposed to 20% stretch for 24 h and parallel nonstretched cells are shown in Fig. 3B.


Figure 3
View larger version (44K):
[in this window]
[in a new window]

 
Fig. 3. Stretch stimulates fetal type II cell proliferation. A: E19 monolayers were incubated with labeled 5-bromo-2'-deoxyuridine (BrdU) before experimental conditions and processed as described in MATERIALS AND METHODS. Cell proliferation was assessed by fluorescence immunocytochemistry counting the percentage of cells incorporating BrdU into nuclei. Values are means ± SE from 3 different experiments. B: representative fluorescence immunocytochemistry fields of E19 type II cells exposed to 20% stretch for 24 h and parallel control samples. BrdU-positive cells are labeled red (arrows). Nuclei were counterstained with DAPI (blue). Scale bar = 50 µm.

 
Effect of stretch on cytokine stimulation. Previous experiments in adult type II epithelial cells have demonstrated that stretch stimulates release of chemokines and cytokines (8, 47). Therefore, we studied whether fetal type II cells show similar response to mechanical stimulation. E19 type II cells were exposed to 5% or 20% of cyclic stretch for 6 h or 24 h. Culture supernatants were collected, and cytokines released into the media were analyzed by ELISA, as described in MATERIALS AND METHODS. Our studies found very low levels of TNF-{alpha} in the supernatant (<25 pg/ml). Stretch did not affect TNF-{alpha} concentration (Fig. 4A), IL-1β, or IL-6 (data not shown). In contrast, IL-8 increased sevenfold (17.3 ± 6.2 vs. 119.8 ± 17.6) and twofold (272 ± 11 vs. 581 ± 8.7) after 20% stretch for 6 h and 24 h, respectively (Fig. 4B). Interestingly, an opposite effect was observed on the concentration of the anti-inflammatory cytokine IL-10 after stretch for 24 h. IL-10 decreased by 60% after 5% stretch (90.8 ± 13.8 vs. 35.3 ± 5) and by 80% (18.5 ± 2.3) after 20% stretch compared with controls (Fig. 4C). Next, we evaluated by qRT-PCR whether IL-8 and IL-10 gene expression were affected by stretch. Based on the ELISA results, we focused these experiments on 20% stretch for 24 h. As shown in Fig. 5, stretch did not affect TNF-{alpha} mRNA gene expression. In contrast, 20% stretch for 24 h increased IL-8 mRNA fivefold (1.8 ± 0.6 vs. 6.1 ± 1.2), whereas IL-10 mRNA decreased by 35% (0.99 ± 0.07 vs. 0.64 ± 0.1) compared with unstretched samples. These data support our ELISA findings.


Figure 4
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 4. Effect of stretch on cytokine release. E19 fetal type II epithelial cells were exposed to 5% or 20% stretch for 6 h or 24 h. Unstretched cells served as controls. Supernatants were collected and processed to assess IL-8, IL-10, and TNF-{alpha} concentrations by ELISA, as described in MATERIALS AND METHODS. Values are means ± SE from 5 different experiments.

 

Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 5. Effect of stretch on cytokine gene expression. Graphical depiction of results from 5 different experiments showing that 20% stretch for 24 h upregulates IL-8 gene and downregulates IL-10 gene. Total RNA was reverse-transcribed, and the cDNA product was analyzed by qRT-PCR using the {Delta}{Delta}CT method for relative quantification.

 
IL-10 administration decreases apoptosis and IL-8 release in fetal type II cells exposed to stretch. Based on the previous findings showing that 20% stretch increases cell death, proliferation, and the concentration of the proinflammatory cytokine IL-8 and decreases the amount of the anti-inflammatory cytokine IL-10, we assessed whether administration of IL-10 before stretch would abrogate some of the injury mediated by mechanical stretch. E19 type II cells were incubated with two different concentrations (100 ng/ml and 300 ng/ml) of rat recombinant IL-10 (rIL-10) before 20% stretch for 24 h. As shown in Fig. 6A, preincubation of type II cells with rIL-10 did not change cell cytotoxicity (as measured by LDH release) or proliferation (data not shown) compared with 20% stretch samples without IL-10. In contrast, apoptosis and IL-8 release were reduced gradually as the concentrations of rIL-10 increased (Fig. 6, B and C). The TUNEL index decreased by 42% in samples preincubated with 300 ng/ml rIL-10 compared with stretched samples without IL-10 (53 ± 3.6 vs. 31 ± 3.6). Similarly, IL-8 release into the supernatant decreased by 15% (383 ± 21) (100 ng/ml rIL-10) and by 25% (339 ± 15) (300 ng/ml rIL-10) compared with untreated samples (450 ± 45). These results support a protective role of IL-10 in fetal type II cells exposed to stretch.


Figure 6
View larger version (16K):
[in this window]
[in a new window]

 
Fig. 6. IL-10 administration decreases apoptosis and IL-8 release in fetal type II cells exposed to stretch. E19 type II cells were preincubated with different concentrations (0, 100, 300 ng/ml) of rat recombinant IL-10 (rIL-10) before applying 20% cyclic stretch for 24 h. Samples were processed to assess cytotoxicity, apoptosis, and IL-8 released into the supernatant as previously described. Results with different concentrations of rIL-10 were compared with samples without IL-10 incubation. Values are means ± SE from 3 different experiments.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The main findings of this study are that injury mediated by stretch of cultured fetal rat type II epithelial cells had opposite effects on IL-8 and IL-10 production. These events promote cell death via necrosis and apoptosis and cellular proliferation. Remarkably, administration of IL-10 protected type II cells from injury secondary to stretch by decreasing apoptosis and IL-8 production.

In our investigations, we used two stretch protocols (5% or 20%) to simulate mechanical forces during lung development or lung injury, respectively. During intrauterine life, the fetus makes episodic breathing movements starting in the first trimester and increasing in frequency up to 30% of the time by birth (12). Although the actual stretch forces to which fetal type II epithelial cells are exposed during lung development are not clearly established, previous studies have suggested that fetal breathing movements may result in repetitive changes in distal lung surface area of ~5% (12). To mimic type II cell injury, we utilized a 20% stretch regimen, which roughly corresponds to a lung inflation of 80% of total lung capacity in adult rats (43).

Mechanical forces can directly disrupt epithelial cell membranes causing cell death via necrosis (45). Our data indicate that 5% stretch and particularly 20% stretch causes necrosis, most likely mediated by plasma membrane stress failure (46). Similar results have been found in adult (7) and fetal rat lung cells (23) exposed to stretch. Putting these results in context, such a degree of deformation could result in type II cell membrane destruction and damage of neighboring cells secondary to release of proinflammatory mediators and other cytosolic components (44).

Apoptosis, in the range of 0–3%, is a physiological event during lung morphogenesis (33, 36). However, excessive apoptosis of epithelial cells can disrupt the epithelial barrier and increase the alveolar-capillary permeability causing alveolar edema and therefore contributing to lung injury and BPD (18). Our investigations demonstrated a significant increase of apoptosis in type II cells exposed to 20% stretch. Previous studies had also found that cyclic stretch of adult rat type II cells induces apoptosis (6, 7), suggesting that programmed cell death is a key mechanism associated with stretch-mediated lung injury. The present data also show that 20% elongation for 24 h promotes type II cell proliferation. Increased apoptosis and concomitant epithelial cell proliferation was also demonstrated in lung tissue sections from preterm infants who required mechanical ventilation (19) and in fetal sheep lungs following intra-amniotic endotoxin stimulation (13).

A key finding from our studies is that IL-8 and IL-10 secretions are influenced by stretch. Under basal conditions, both IL-8 and IL-10 concentrations increased over time (see control samples at 6 h and 24 h in Fig. 4, B and C) suggesting that under nonstimulated conditions, IL-10 may have a counterregulatory effect to minimize inflammation. However, after 24 h of cyclic stretch, this potential protective effect is lost. Whereas IL-8 secretion is further stimulated by 5% or 20% stretch, IL-10 values were decreased with higher magnitudes of stretch. Previous studies also found that cyclic stretch of human alveolar type II cells enhanced both gene expression and release of IL-8 in a stretch amplitude-dependent manner, whereas no effect was observed on TNF-{alpha} release (47). Failure of increase in IL-10 release was also noticed in rat adult alveolar type II cells when high amplitude of stretch (30%) was applied (8). Together, these results support our hypothesis and suggest that one of the potential mechanisms for the inflammatory response of fetal type II cells to mechanical injury is the imbalance between pro- and anti-inflammatory cytokines. The cellular mechanisms regulating stretch-induced cytokine production are not clearly established. Past studies have involved calcium channels (4), mitogen-activated protein kinase pathways (15, 29), and stress failure of the plasma membrane (44).

One of the novelties of our experiments with potential translational implications is that preincubation with recombinant IL-10 attenuated apoptosis and IL-8 release in fetal type II cells exposed to high amplitude of stretch. We did not observe any protective effect on LDH release. A plausible explanation is that stretch-induced release of LDH might be principally mediated by disruption of the cell membrane, and, therefore, independent of IL-10 receptor and downstream signaling pathways. IL-10 administration was found to decrease the proinflammatory cytokines IL-1β, IL-8, and macrophage inflammatory protein-1{alpha} (MIP) in cultured macrophages and neutrophils isolated from newborns (5, 14, 42). In animal models of acute lung injury generated by immune complexes or LPS administration, intratracheal instillation of IL-10 also reduced inflammation by decreasing neutrophil accumulation and TNF-{alpha} expression (24, 39). However, to our knowledge, the potential benefits of IL-10 treatment in experimental BPD induced by mechanical ventilation have not been investigated. Interestingly, in a murine model of lung injury, intratracheal delivery of low levels of adenoviral vectors expressing IL-10 was associated with improved outcome. However, increased systemic inflammation and worse outcome was observed with higher doses of adenoviruses (20). These findings suggest that although IL-10 could be a feasible therapeutic option to target lung inflammation, excessive administration could be detrimental. Although further in vitro and in vivo studies are still necessary, we speculate that IL-10 might be a potential anti-inflammatory agent in the prevention and/or treatment of BPD.

The mechanisms by which IL-10 administration reduces type II cell injury secondary to stretch are unknown. However, the IL-10/IL-8 axis could be the target for this effect. IL-10 could reduce apoptosis and IL-8 production by inhibiting the activation of NF-{kappa}B, a pivotal transcription factor modulating inflammation (1) and stretch-induced IL-8 gene expression and release (15). Another potential mechanism is by direct modulation of IL-8 receptors and IL-8 secretion or by downregulation of FasL expression via IL-8 (38).

Our study has the limitations inherent to an in vitro experimental system in which E19 type II cells were isolated from their environment. Therefore, our results should be interpreted cautiously. However, recent in vivo studies (2, 3) have shown that mechanical ventilation of newborn mice induced apoptosis and impaired alveolar septation. These investigations propose that prolonged exposure to cyclic stretch might be an independent potential mechanism for disruption of lung development.

In summary, our results suggest that excessive stretch of fetal type II cells induces necrosis, apoptosis, and imbalance between pro- and anti-inflammatory cytokines. Although the data presented here need to be validated with in vivo models, our in vitro studies suggest that IL-10 might be a promising therapeutic strategy to prevent and/or minimize lung injury secondary to mechanical ventilation in premature infants susceptible to BPD.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by grants from Kangwon National University, Chuncheon, South Korea, and National Institutes of Health Grants RR-018728 and HD-041701.


    ACKNOWLEDGMENTS
 
We thank Brenda Vecchio for manuscript preparation.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. Sanchez-Esteban, Dept. of Pediatrics, Women & Infants Hospital of Rhode Island, 101 Dudley St., Providence, RI 02905 (e-mail: jsanchezesteban{at}wihri.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Barnes PJ, Karin M. Nuclear factor-kappaB: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 336: 1066–1071, 1997.[Free Full Text]
  2. Bland RD, Ertsey R, Mokres LM, Xu L, Jacobson BE, Jiang S, Alvira CM, Rabinovitch M, Shinwell ES, Dixit A. Mechanical ventilation uncouples synthesis and assembly of elastin and increases apoptosis in lungs of newborn mice. Prelude to defective alveolar septation during lung development? Am J Physiol Lung Cell Mol Physiol (October 12, 2007). doi:10.1152/ajplung.00362.2007.[Abstract/Free Full Text]
  3. Bland RD, Mokres LM, Ertsey R, Jacobson BE, Jiang S, Rabinovitch M, Xu L, Shinwell ES, Zhang F, Beasley MA. Mechanical ventilation with 40% oxygen reduces pulmonary expression of genes that regulate lung development and impairs alveolar septation in newborn mice. Am J Physiol Lung Cell Mol Physiol 293: L1099–L1110, 2007.[Abstract/Free Full Text]
  4. Copland IB, Post M. Stretch-activated signaling pathways responsible for early response gene expression in fetal lung epithelial cells. J Cell Physiol 210: 133–143, 2007.[CrossRef][Web of Science][Medline]
  5. Davidson D, Miskolci V, Clark DC, Dolmaian G, Vancurova I. Interleukin-10 production after proinflammatory stimulation of neutrophils and monocytic cells of the newborn. Comparison to exogenous interleukin-10 and dexamethasone levels needed to inhibit chemokine release. Neonatology 92: 127–133, 2007.[CrossRef][Web of Science][Medline]
  6. Edwards YS, Sutherland LM, Power JH, Nicholas TE, Murray AW. Cyclic stretch induces both apoptosis and secretion in rat alveolar type II cells. FEBS Lett 448: 127–130, 1999.[CrossRef][Web of Science][Medline]
  7. Hammerschmidt S, Kuhn H, Grasenack T, Gessner C, Wirtz H. Apoptosis and necrosis induced by cyclic mechanical stretching in alveolar type II cells. Am J Respir Cell Mol Biol 30: 396–402, 2004.[Abstract/Free Full Text]
  8. Hammerschmidt S, Kuhn H, Sack U, Schlenska A, Gessner C, Gillissen A, Wirtz H. Mechanical stretch alters alveolar type II cell mediator release toward a proinflammatory pattern. Am J Respir Cell Mol Biol 33: 203–210, 2005.[Abstract/Free Full Text]
  9. Hanna N, Bonifacio L, Weinberger B, Reddy P, Murphy S, Romero R, Sharma S. Evidence for interleukin-10-mediated inhibition of cyclo-oxygenase-2 expression and prostaglandin production in preterm human placenta. Am J Reprod Immunol 55: 19–27, 2006.[Medline]
  10. Jobe AH, Ikegami M. Mechanisms initiating lung injury in the preterm. Early Hum Dev 53: 81–94, 1998.[CrossRef][Web of Science][Medline]
  11. Jones CA, Cayabyab RG, Kwong KY, Stotts C, Wong B, Hamdan H, Minoo P, deLemos RA. Undetectable interleukin (IL)-10 and persistent IL-8 expression early in hyaline membrane disease: a possible developmental basis for the predisposition to chronic lung inflammation in preterm newborns. Pediatr Res 39: 966–975, 1996.[Web of Science][Medline]
  12. Kitterman JA. The effects of mechanical forces on fetal lung growth. Clin Perinatol 23: 727–740, 1996.[Web of Science][Medline]
  13. Kramer BW, Kramer S, Ikegami M, Jobe AH. Injury, inflammation, and remodeling in fetal sheep lung after intra-amniotic endotoxin. Am J Physiol Lung Cell Mol Physiol 283: L452–L459, 2002.[Abstract/Free Full Text]
  14. Kwong KY, Jones CA, Cayabyab R, Lecart C, Khuu N, Rhandhawa I, Hanley JM, Ramanathan R, deLemos RA, Minoo P. The effects of IL-10 on proinflammatory cytokine expression (IL-1beta and IL-8) in hyaline membrane disease (HMD). Clin Immunol Immunopathol 88: 105–113, 1998.[CrossRef][Web of Science][Medline]
  15. Li LF, Ouyang B, Choukroun G, Matyal R, Mascarenhas M, Jafari B, Bonventre JV, Force T, Quinn DA. Stretch-induced IL-8 depends on c-Jun NH2-terminal and nuclear factor-{kappa}B-inducing kinases. Am J Physiol Lung Cell Mol Physiol 285: L464–L475, 2003.[Abstract/Free Full Text]
  16. Liggins GC. Growth of the fetal lung. J Dev Physiol 6: 237–248, 1984.[Web of Science][Medline]
  17. Marchant A, Bruyns C, Vandenabeele P, Ducarme M, Gerard C, Delvaux A, De Groote D, Abramowicz D, Velu T, Goldman M. Interleukin-10 controls interferon-gamma and tumor necrosis factor production during experimental endotoxemia. Eur J Immunol 24: 1167–1171, 1994.[Web of Science][Medline]
  18. Martin TR, Hagimoto N, Nakamura M, Matute-Bello G. Apoptosis and epithelial injury in the lungs. Proc Am Thorac Soc 2: 214–220, 2005.
  19. May M, Strobel P, Preisshofen T, Seidenspinner S, Marx A, Speer CP. Apoptosis and proliferation in lungs of ventilated and oxygen-treated preterm infants. Eur Respir J 23: 113–121, 2004.[Abstract/Free Full Text]
  20. McAuliffe PF, Murday ME, Efron PA, Scumpia PO, Ungaro R, Abouhamze A, Tannahill CL, Hutchins B, LaFace D, Moldawer LL. Dose-dependent improvements in outcome with adenoviral expression of interleukin-10 in a murine model of multisystem organ failure. Gene Ther 13: 276–282, 2006.[CrossRef][Medline]
  21. Moessinger AC, Harding R, Adamson TM, Singh M, Kiu GT. Role of lung fluid volume in growth and maturation of the fetal sheep lung. J Clin Invest 86: 1270–1277, 1990.[Web of Science][Medline]
  22. Mondestin-Sorrentino M, Smulian JC, Vintzileos AM, Sorrentino D, Ananth CV, Sharma S, Hanna NN. Variations in cervical IL-10 and IL-8 concentrations throughout gestation in normal pregnancies. Am J Reprod Immunol 57: 482–487, 2007.[Medline]
  23. Mourgeon E, Isowa N, Keshavjee S, Zhang X, Slutsky AS, Liu M. Mechanical stretch stimulates macrophage inflammatory protein-2 secretion from fetal rat lung cells. Am J Physiol Lung Cell Mol Physiol 279: L699–L706, 2000.[Abstract/Free Full Text]
  24. Mulligan MS, Warner RL, Foreback JL, Shanley TP, Ward PA. Protective effects of IL-4, IL-10, IL-12, and IL-13 in IgG immune complex-induced lung injury: role of endogenous IL-12. J Immunol 159: 3483–3489, 1997.[Abstract]
  25. Munshi UK, Niu JO, Siddiq MM, Parton LA. Elevation of interleukin-8 and interleukin-6 precedes the influx of neutrophils in tracheal aspirates from preterm infants who develop bronchopulmonary dysplasia. Pediatr Pulmonol 24: 331–336, 1997.[CrossRef][Web of Science][Medline]
  26. Murphy SP, Fast LD, Hanna NN, Sharma S. Uterine NK cells mediate inflammation-induced fetal demise in IL-10-null mice. J Immunol 175: 4084–4090, 2005.[Abstract/Free Full Text]
  27. Oei J, Lui K, Wang H, Henry R. Decreased interleukin-10 in tracheal aspirates from preterm infants developing chronic lung disease. Acta Paediatr 91: 1194–1199, 2002.[Web of Science][Medline]
  28. Opal SM, DePalo VA. Anti-inflammatory cytokines. Chest 117: 1162–1172, 2000.[CrossRef][Web of Science][Medline]
  29. Oudin S, Pugin J. Role of MAP kinase activation in interleukin-8 production by human BEAS-2B bronchial epithelial cells submitted to cyclic stretch. Am J Respir Cell Mol Biol 27: 107–114, 2002.[Abstract/Free Full Text]
  30. Rama KM, Acarregui MJ, Snyder JM. Differentiation of the alveolar epithelium in the fetal lung. In: Lung Growth and Development, edited by McDonald JA. New York: Marcel Dekker, 1997, p. 119–162.
  31. Sanchez-Esteban J, Cicchiello LA, Wang Y, Tsai SW, Williams LK, Torday JS, Rubin LP. Mechanical stretch promotes alveolar epithelial type II cell differentiation. J Appl Physiol 91: 589–595, 2001.[Abstract/Free Full Text]
  32. Sanchez-Esteban J, Tsai SW, Sang J, Qin J, Torday JS, Rubin LP. Effects of mechanical forces on lung-specific gene expression. Am J Med Sci 316: 200–204, 1998.[CrossRef][Web of Science][Medline]
  33. Sanchez-Esteban J, Wang Y, Cicchiello LA, Rubin LP. Cyclic mechanical stretch inhibits cell proliferation and induces apoptosis in fetal rat lung fibroblasts. Am J Physiol Lung Cell Mol Physiol 282: L448–L456, 2002.[Abstract/Free Full Text]
  34. Sanchez-Esteban J, Wang Y, Filardo EJ, Rubin LP, Ingber DE. Integrins β1, {alpha}6, and {alpha}3 contribute to mechanical strain-induced differentiation of fetal lung type II epithelial cells via distinct mechanisms. Am J Physiol Lung Cell Mol Physiol 290: L343–L350, 2006.[Abstract/Free Full Text]
  35. Sanchez-Esteban J, Wang Y, Gruppuso PA, Rubin LP. Mechanical stretch induces fetal type II cell differentiation via an epidermal growth factor receptor-extracellular-regulated protein kinase signaling pathway. Am J Respir Cell Mol Biol 30: 76–83, 2004.[Abstract/Free Full Text]
  36. Scavo LM, Ertsey R, Chapin CJ, Allen L, Kitterman JA. Apoptosis in the development of rat and human fetal lungs. Am J Respir Cell Mol Biol 18: 21–31, 1998.[Abstract/Free Full Text]
  37. Schultz C, Tautz J, Reiss I, Moller JC. Prolonged mechanical ventilation induces pulmonary inflammation in preterm infants. Biol Neonate 84: 64–66, 2003.[CrossRef][Medline]
  38. Selam B, Kayisli UA, Garcia-Velasco JA, Akbas GE, Arici A. Regulation of fas ligand expression by IL-8 in human endometrium. J Clin Endocrinol Metab 87: 3921–3927, 2002.[Abstract/Free Full Text]
  39. Shanley TP, Vasi N, Denenberg A. Regulation of chemokine expression by IL-10 in lung inflammation. Cytokine 12: 1054–1064, 2000.[CrossRef][Web of Science][Medline]
  40. Speer CP. Inflammation and bronchopulmonary dysplasia. Semin Neonatol 8: 29–38, 2003.[CrossRef][Medline]
  41. Speer CP. Inflammatory mechanisms in neonatal chronic lung disease. Eur J Ped 158, Suppl 1: S18–S22, 1999.[CrossRef][Web of Science][Medline]
  42. Tryzmel J, Miskolci V, Castro-Alcaraz S, Vancurova I, Davidson D. Interleukin-10 inhibits proinflammatory chemokine release by neutrophils of the newborn without suppression of nuclear factor-kappa B. Pediatr Res 54: 382–386, 2003.[CrossRef][Medline]
  43. Tschumperlin DJ, Oswari J, Margulies AS. Deformation-induced injury of alveolar epithelial cells. Effect of frequency, duration, and amplitude. Am J Respir Crit Care Med 162: 357–362, 2000.[Abstract/Free Full Text]
  44. Uhlig S. Ventilation-induced lung injury and mechanotransduction: stretching it too far? Am J Physiol Lung Cell Mol Physiol 282: L892–L896, 2002.[Abstract/Free Full Text]
  45. Vlahakis NE, Hubmayr RD. Cellular stress failure in ventilator-injured lungs. Am J Respir Crit Care Med 171: 1328–1342, 2005.[Abstract/Free Full Text]
  46. Vlahakis NE, Hubmayr RD. Invited review: plasma membrane stress failure in alveolar epithelial cells. J Appl Physiol 89: 2490–2496; discussion 2497, 2000.[Abstract/Free Full Text]
  47. Vlahakis NE, Schroeder MA, Limper AH, Hubmayr RD. Stretch induces cytokine release by alveolar epithelial cells in vitro. Am J Physiol Lung Cell Mol Physiol 277: L167–L173, 1999.[Abstract/Free Full Text]
  48. Wang Y, Maciejewski BS, Lee N, Silbert O, McKnight NL, Frangos JA, Sanchez-Esteban J. Strain-induced fetal type II epithelial cell differentiation is mediated via cAMP-PKA-dependent signaling pathway. Am J Physiol Lung Cell Mol Physiol 291: L820–L827, 2006.[Abstract/Free Full Text]
  49. Wirtz HR, Dobbs LG. Calcium mobilization and exocytosis after one mechanical stretch of lung epithelial cells. Science 250: 1266–1269, 1990.[Abstract/Free Full Text]
  50. Yamamoto H, Teramoto H, Uetani K, Igawa K, Shimizu E. Cyclic stretch upregulates interleukin-8 and transforming growth factor-beta1 production through a protein kinase C-dependent pathway in alveolar epithelial cells. Respirology 7: 103–109, 2002.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
J. Physiol.Home page
Y. Wang, B. S. Maciejewski, D. Soto-Reyes, H.-S. Lee, D. Warburton, and J. Sanchez-Esteban
Mechanical stretch promotes fetal type II epithelial cell differentiation via shedding of HB-EGF and TGF-{alpha}
J. Physiol., April 15, 2009; 587(8): 1739 - 1753.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
P. R. Pedreira, E. Garcia-Prieto, D. Parra, A. Astudillo, E. Diaz, F. Taboada, and G. M. Albaiceta
Effects of melatonin in an experimental model of ventilator-induced lung injury
Am J Physiol Lung Cell Mol Physiol, November 1, 2008; 295(5): L820 - L827.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/2/L225    most recent
00370.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, H.-S.
Right arrow Articles by Sanchez-Esteban, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, H.-S.
Right arrow Articles by Sanchez-Esteban, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.