Abstract

The ontogeny of the C-C chemokines eotaxin-1, eotaxin-2, and eotaxin-3 has not been fully elucidated in human lung. We explored a possible role for eotaxin in developing lung by determining the ontogeny of eotaxin-1 (CCL11), eotaxin-2 (CCL24), eotaxin-3 (CCL26), and the eotaxin receptor, CCR3. We tested discarded surgical samples of developing human lung tissue using quantitative RT-PCR (QRT-PCR) and immunostaining for expression of CCL11, CCL24, CCL26, and CCR3. We assessed possible functionality of the eotaxin-CCR3 system by treating lung explant cultures with exogenous CCL11 and analyzing the cultures for evidence of changes in proliferation and activation of ERK1/2, a signaling pathway associated with CCR3. QRT-PCR analyses of 22 developing lung tissue samples with gestational ages 10–23 wk demonstrated that eotaxin-1 mRNA is most abundant in developing lung, whereas mRNAs for eotaxin-2 and eotaxin-3 are minimally detectable. CCL11 mRNA levels correlated with gestational age (P < 0.05), and immunoreactivity was localized predominantly to airway epithelial cells. QRT-PCR analysis detected CCR3 expression in 16 of 19 developing lung samples. Supporting functional capacity in the immature lung, CCL11 treatment of lung explant cultures resulted in significantly increased (P < 0.05) cell proliferation and activation of the ERK signaling pathway, which is downstream from CCR3, suggesting that proliferation was due to activation of CCR3 receptors by CCL11. We conclude that developing lung expresses the eotaxins and functional CCR3 receptor. CCL11 may promote airway epithelial proliferation in the developing lung.

  • pulmonary development
  • embryonic
  • epithelium

the eotaxins are members of the macrophage chemoattractant protein/eotaxin chemokines, a small subfamily of C-C chemokines. Three eotaxins have been identified, eotaxin-1/CCL11 (CCL11) (53), eotaxin-2/CCL24 (CCL24) (13), and eotaxin-3/CCL26 (CCL26) (31), all of which activate the C-C chemokine receptor-3 (CCR3) (11, 15, 30) and share several functions, such as eosinophil chemoattraction and activation (30, 31, 42, 57, 62). The eotaxins are associated with allergic diseases (18, 25, 29, 34, 35, 44, 45, 53, 5759, 62, 69, 72, 74, 75) and are increased in atopic dermatitis (5, 24), allergic conjunctivitis (37), asthma (35, 38, 41, 76), and nasal polyposis (4, 61). Additionally, these chemokines are increased in nonallergic syndromes characterized by eosinophilic tissue infiltrates, such as inflammatory bowel disease (6, 16, 28, 36, 46) and bullous pemphigoid (1, 14, 20, 67).

In contrast to diseases associated with eosinophilia, the role of the eotaxins in processes where eosinophils are rare or absent has not been fully elucidated. Recent studies indicate that the eotaxins have significant roles in noneosinophilic inflammatory processes. For example, CCL11 is chemoattractant for basophils (71) and can act as a colony-stimulating factor for myeloid cells (52). Eotaxin expression is present in cell cultures of T lymphocytes (18). CCL11 modulates the secretion of interferon-γ from T helper type 1 (Th1) T cells in a model of murine pulmonary granuloma formation (60) and has been implicated in the pathophysiology of vascular inflammation in rats (7) and in humans (22). Cumulatively, these observations suggest that eotaxins have a biological role beyond the recruitment of eosinophils and allergic inflammatory cells.

One possible such role is promoting the differentiation of the normal human lung. It is unknown whether the eotaxins are expressed or functional in normal developing human lung, an environment typically containing few, if any, eosinophils. We tested the hypothesis that eotaxin is present and active during human lung development. First, we determined the ontogeny of CCL11, CCL24, CCL26, and their receptor, CCR3, in developing lung. Our observation that the eotaxins are present in developing human lung where eosinophils are rarely appreciated caused us to ask whether the eotaxin-CCR3 receptor-ligand system has effects on developing human airways that might not be easily appreciated in animal models. We therefore investigated the possible functionality of the eotaxin-CCR3 receptor-ligand system in the immature lung by testing the responsiveness of these tissues to exogenous CCL11 in human lung explant cultures. Our findings indicate that explant cultures respond to CCL11 with increased indices of proliferation and activation of ERK1/2. Thus our study demonstrates a possible function for the eotaxin/CCR3 system in the developing human lung.

METHODS

Study protocol.

The Brigham and Women's Hospital's Human Research Committee reviewed and approved the study protocol, and each subject gave written informed consent for use of discarded surgical material and completion of a questionnaire regarding past medical and family history.

RNA extraction and analysis (RT-PCR and qPCR).

Total RNA was prepared from 29 first and second trimester (gestational age 10–23 wk) lung tissue samples obtained from discarded surgical specimens and processed for histological and RNA analyses as previously described (23). RNA (1 μg) from 21 of these samples was treated with DNase (Invitrogen, Carlsbad, CA) following manufacturer's instructions before reverse transcription. Reverse transcription to cDNA was performed using the RETROscript reverse transcription kit (Ambion, Austin, TX), following the manufacturer's instructions. RT-PCR analysis was performed on the resulting cDNAs as previously described, using primer pairs yielding products spanning at least one intron (23). CCL11 primer sequences (Integrated DNA Technologies, Coralville, IA) were sense acaccttcagcctccaacat and antisense cacagctttctggggacatt, and cyclophilin primers (Gene Link, Hawthorne, NY) were sense aggtcccaaagacagcagaa and antisense tgtccacagtcagcaatggt. The PCR products were analyzed using ethidium bromide-stained 2% agarose gels; only samples yielding a robust band for cyclophilin on the ethidium gel were studied in subsequent quantitative PCR experiments.

We used TaqMan Universal Master Mix (Applied Biosystems, Foster City, CA) and validated (2) TaqMan gene expression assay primer/probe combinations for CCL11 (assay ID Hs 00237013_m1), CCL24 (assay ID Hs 00171082_m1), CCL26 (assay ID Hs 00171146_m1), CCR3 (assay ID Hs 00266213_s1), and the endogenous control 18S (cat. no. 4333760T) following manufacturer's instructions for real-time quantitative PCR (qPCR) analyses. Except for CCR3, the PCR products all spanned at least one intron. The CCR3 analysis used cDNA prepared from DNase-treated RNA. All qPCR results were normalized to the expression of the endogenous positive control 18S. Comparison of the expression levels of the mRNA encoding CCL11 among the lung tissues samples used the expression of CCL11 normalized to that of the endogenous control, 18S, as previously reported (70). Comparisons of the expression levels of the mRNAs encoding CCL11, CCL24, and CCL26 were performed using the ΔΔCt cycle threshold method among developing lung samples that had been tested for expression of all three eotaxins.

Histological and immunohistochemical analyses.

Hematoxylin and eosin (H&E) stains and immunostaining using an avidin-biotin technique were performed in 36 samples with gestational ages between 10–23 wk as previously described (22, 23). Primary antisera included murine anti-CCL11 (dilution 1:50, gift of P. Ponath), rabbit anti-phosphorylated ERK1/2 (dilution 1:50; Cell Signaling, Beverly, MA), murine anti-PCNA (clone PC10, dilution 1:75; Dako Cytomation, Carpinteria, CA), rabbit anti-vimentin (dilution 1:250; Abcam), and rabbit anti-cytokeratin (dilution 1:1,000; Dako Cytomation). Pretreatments with heat antigen retrieval (ERK1/2), methanol (PCNA), and trypsin (cytokeratin) were used as needed. Substitution of primary antibodies with irrelevant murine and rabbit IgG (Sigma Chemical, St. Louis, MO) were the negative controls. Immunostaining results were assessed as previously described (22, 23).

Double stains were used to confirm colocalization of specific cell type markers. For the eotaxin and cytokeratin staining, eotaxin staining was performed as outlined above. Then, slides were treated with trypsin, and a murine cytokeratin at 1:500 (Sigma Chemical) was applied for 1 h at room temperature. Following washing, donkey anti-mouse secondary antibody labeled with alkaline phosphatase (DM-AP; Jackson ImmunoResearch Laboratories, West Grove, PA) at 1:500 was applied for one-half hour at room temperature, and the antibody was visualized using Dako Permanent Red (Dako Cytomation) according to the manufacturer's instructions. Eotaxin immunostaining was identified by brown color, and cytokeratin by red. For the PCNA and cytokeratin staining, murine anti-PCNA (Dako Cytomation) was applied for 1 h at room temperature to slides following incubation with methanol. Following washing, DM-AP was applied, and the antibody visualized using Dako Permanent Red as outlined above. The slides were treated with trypsin followed by rabbit anti-cytokeratin at 1:1,000 (Dako Cytomation). Following washing, goat anti-rabbit biotinylated secondary antibody at 1:200 (Vector Laboratories, Burlingame, CA) was applied for one-half hour at room temperature, endogenous peroxidases were blocked using ethanol (Fisher Chemical) with 1.5% hydrogen peroxide (Thermo Fisher Scientific, Waltham, MA) at room temperature for 15 min, and the antibody was visualized using Vector SG (Vector Laboratories) according to the manufacturer's instructions. PCNA immunostaining was identified by red staining, cytokeratin by gray-blue, and colocalization of PCNA and cytokeratin in the same cellular area by purple. Double staining for ERK1/2 and cytokeratin was performed as above for ERK1/2 using a 1:25 dilution followed by DM-AP at room temperature for 30 min and visualized using Dako Permanent Red (Dako Cytomation). Slides were then treated with trypsin, and murine anti-cytokeratin 1:750 (Sigma Chemical) was applied for 1 h at room temperature, followed by biotinylated horse anti-mouse at 1:200 (Vector Laboratories) and visualized as above with Vector SG (Vector Laboratories). ERK1/2 immunostaining was identified by red staining, cytokeratin by gray-blue, and colocalization of ERK1/2 and cytokeratin in the same cellular area by purple.

Organ explant culture.

Organ explant cultures were prepared and maintained for 5 days as previously described (64) from three lung tissue samples with gestational ages 17, 21, and 23 wk obtained from discarded surgical samples. Each lung tissue sample was divided into three explant cultures. CCL11 (PeproTech, Rocky Hill, NJ) was added daily to the cultures in doses of 0, 12, and 120 nM, which encompassed the range of eotaxin concentrations previously reported (52, 55). The explant culture samples were harvested after 5 days of culture, fixed in 4% paraformaldehyde, routinely processed, and embedded in paraffin for histological analyses, including immunostaining for PCNA and ERK1/2, as outlined below.

Statistical analyses.

Statistical analyses of qPCR and immunostaining results used ANOVA on ranks. Comparison of the presence or absence of CCL11 immunostaining used χ2 analysis. Correlations between CCL11 mRNA expression and ERK1/2 immunostaining with gestational age and questionnaire results were assessed using linear regression analysis. Effects of CCL11 treatment of explants were analyzed by two-way ANOVA. For all analyses, differences were considered significant if P < 0.05.

RESULTS

Ontogeny of the eotaxins.

Sixty-five lung tissue samples from developing lung were obtained and processed for RNA (n = 29) and histology (n = 36) studies. Of these, four samples were processed for both RNA and histological analyses.

We first determined whether any of the eotaxins could be detected in normal developing human lung. Since previous investigators had demonstrated greater abundance of CCL11 compared with other eotaxins (12, 56, 74), we reasoned that it was likely that CCL11 would be the most readily identified member of the eotaxins and so focused these initial studies on this chemokine. Whole lung RNA was prepared, and cDNA was made from 29 lung tissue samples having gestational ages between 10–23 wk. The samples were then analyzed by RT-PCR analysis for expression of the endogenous control gene cyclophilin (49): 25 of 29 samples expressed cyclophilin (Fig. 1A). Using primers designed to span at least 1 intron, which permits discrimination between cDNA derived from mRNA and contaminating genomic DNA, a PCR product of the expected base pair size (206) for the mRNA encoding CCL11 was demonstrated in 22 of the 25 samples expressing cyclophilin (Fig. 1A).

Fig. 1.

A: ethidium bromide-stained gel of RT-PCR analysis demonstrating expression of the mRNA encoding CCL11 in samples of developing human lung with gestational ages 10–22 wk. The endogenous control mRNA for cyclophilin is presented to show equal loading among the samples. No band was identified in the negative control (No RT) lane. GA, gestational age; Pos, positive control (cDNA prepared from A549 cells treated with interleukin-1β, which has been shown to induce CCL11 expression in these cells; Ref. 39). B: quantitative PCR analysis demonstrating expression of the mRNA encoding CCL11 normalized to expression of the endogenous control 18S in developing human lung. C: quantitative PCR analysis demonstrating increased expression of the mRNA encoding eotaxin correlated significantly (P < 0.05) with increasing gestational age.

Next, we examined the quantitative expression of the eotaxins among the 22 developing human lung samples identified as expressing CCL11 mRNA by RT-PCR by subjecting them to real-time qPCR (Fig. 1B). The expression of the endogenous control 18S was used to normalize the expression of the mRNA for each primer. The majority of the samples were analyzed for expression of all three eotaxins (CCL11, CCL24, and CCL26) and CCR3. However, due to the limited amount of study material available for some samples, a few were only analyzed for CCL11 and eotaxin-2 CCL24 expression. The qPCR analysis demonstrated significant differences in the amount of CCL11 mRNA expression among the samples (P < 0.05), and linear regression analysis showed a significant correlation between CCL11 mRNA expression and increasing gestational age (P < 0.05; Fig. 1C). Since the sample with gestational age 13 wk had much lower eotaxin-1 mRNA expression than the other samples with gestational ages less than 15 wk, the analysis was repeated omitting this sample. This second analysis confirmed a strong trend toward increased CCL11 mRNA expression with increased gestational age, with P = 0.055. Analyzing the expression of CCL11 by trimester confirmed significantly greater (P < 0.05) mRNA expression in the samples from the second trimester (n = 20) compared with the first trimester samples (n = 3). Additionally, there was a trend toward a direct correlation between CCL11 expression and a family history of asthma and/or atopy. The maternal questionnaires for 13 of the 23 samples and 6 of the 7 of the samples with the highest levels of CCL11 mRNA expression had positive responses to queries about health professional-diagnosed asthma and/or atopy symptoms.

qPCR also detected the mRNA encoding CCL24 in 11 of 22 and CCL26 in 13 of 21 developing lung tissue samples. All of the samples analyzed by qPCR demonstrated abundant expression of the mRNA encoding 18S. There was a trend for more abundant CCL26 mRNA in samples less than 19 wk gestational age in that 7 of 7 samples between gestational ages 10–18 wk expressed the mRNA encoding CCL26, but only 6 of 14 samples with gestational age greater than 18 wk did. Expression levels among CCL11, CCL24, and CCL26 were compared using the ΔΔCt method (2). ANOVA on ranks comparing the ΔΔCt values in 13 lung tissue samples that had qPCR analyses for all 3 eotaxins showed that CCL11 mRNA had greater abundance than either CCL11 or CCL26 in lung tissue samples at all gestational ages tested and that this difference was significantly greater for both CCL24 (P < 0.05) and CCL26 (P < 0.05) in our samples of gestational age of at least 15 wk (n = 10; Fig. 2).

Fig. 2.

Comparison of the expression of CCL11, CCL24, and CCL26 in developing human lung using quantitative PCR analysis. Box plot showing median and 25–75% quartile expression levels of the mRNAs encoding CCL11, CCL24, and CCL26 normalized to 18S expression is reported for lung samples from both the 1st (n = 3) and 2nd (n = 10) trimester. The 10th and 90th percentile ranges are indicated by dots below and above the ranges for the 2nd trimester samples. For comparison, the stage of lung development (pseudoglandular from gestational age 5–15 wk and canalicular starting at gestational age 16 wk) corresponding to the gestational ages is provided below the graph.

Although eotaxin is thought to be transcriptionally regulated (39), the immature lung does not make protein for all expressed mRNAs (68). We therefore used immunohistochemical analysis to assess whether the developing human lung expresses eotaxin protein. We focused these studies on immunostaining for CCL11 because this eotaxin consistently demonstrated the greatest abundance of mRNA in our samples. Immunostaining performed in 36 paraffin-embedded lung tissue samples detected CCL11 protein in 17 out of 36 samples of developing human lung with gestational ages between 11–23 wk (Fig. 3, a and b). The majority of the immunopositive cells colocalized with cytokeratin, identifying them as epithelial cells (Fig. 3, c and d). Specificity was demonstrated by substituting the primary antibody with an irrelevant IgG, which ablated the immunostaining (Fig. 3, e and f). The likelihood of immunostaining was significantly greater in samples with a gestational age less than 20 wk: 16 out of 23 samples with gestational ages between 11–19 wk demonstrated immunopositive cells, whereas 3 out of 13 samples with gestational ages at least 20 wk demonstrated immunopositive cells (P < 0.05). This is in contrast to the mRNA expression, which demonstrated a direct correlation with gestational age. Since CCL11 is known to be a chemoattractant for eosinophils, we tested for evidence of eosinophilic infiltrates in our developing lung tissue samples by examining H&E-stained sections. Despite protein and mRNA expression of the eotaxins, H&E staining did not detect tissue eosinophils in any sample, with a minimum of 10 high-power fields examined per sample.

Fig. 3.

Immunostaining demonstrating expression of eotaxin protein in human lung in both the pseudoglandular and canalicular stages of development. a: Immunostaining for CCL11 in developing lung with gestational age 12 wk. Magnification, ×200. b: Immunostaining for CCL11 in developing lung with gestational age 21.5 wk. Magnification, ×200. c: Immunostaining in developing lung with gestational age 16 wk with brown staining indicating cells immunopositive for CCL11. Magnification, ×200. d: Same tissue section shown in c, immunostained for cytokeratin, an epithelial cell marker, with red indicating cells immunopositive for cytokeratin. Magnification, ×200. Inset shows detail of colocalization of the 2 chromagens, consistent with expression of CCL11 by epithelial cells. Magnification, ×1,000. e: Immunostaining for CCL11 in developing human lung with gestational age 16 wk. Magnification, ×200. f: Substitution of the primary antibody with irrelevant IgG in the same sample shown in e demonstrates ablation of immunostaining. Magnification, ×200.

Ontogeny of CCR3.

We examined the expression of the eotaxin receptor, CCR3, by using qPCR to compare the abundance of mRNA encoding CCR3 to that of 18S. All of the RNA samples used for this assay were treated with DNase before being subjected to reverse transcription since the primer set used for this analysis did not span an intron. All of the samples expressed abundant 18S by qPCR following DNase treatment. The mRNA encoding CCR3 was detected in 16 of 19 samples of developing human lung with gestational ages between 10–23 wk. Samples of 21.5 wk gestation and older had low levels of CCR3 mRNA detected. All samples that expressed the mRNA encoding CCR3 also expressed the mRNA for CCL11 (Fig. 4).

Fig. 4.

Expression of eotaxin receptor CCR3 in developing human lung. Quantitative PCR analysis of the mRNA encoding CCR3, normalized to 18S expression. Sixteen of nineteen samples of developing human lung tissue with gestational ages 10–22 wk demonstrated expression of CCR3 mRNA; all samples expressing CCR3 had also expressed CCL11.

Functional capacity of eotaxin in developing lung.

We examined the functional consequences of CCR3 ligation by CCL11 in a model of human lung development. We measured the effects of exogenous CCL11 on cell proliferation in fetal lung tissue explant tissue culture. Cell proliferation was assessed by immunostaining for PCNA. Explant cultures prepared from 3 samples of developing lung tissue with gestational ages 17, 21, and 23 wk were each treated with 0 (controls), 12 nM, and 120 nM CCL11. Since the half-life of eotaxin in culture is ∼2 h (3), the cultures were treated with eotaxin every day. Two-way ANOVA demonstrated that the effects of eotaxin depended on both the concentration of eotaxin, with the maximal effects noted at 12 nM, and the gestational age of the sample, with little to no increase in proliferation noted in cultures from the 23 wk-gestation lung (P < 0.05). ANOVA on ranks showed significantly (P < 0.05) increased tissue area percent positive for PCNA after CCL11 treatment in the cultures prepared from the 17- and 21-wk lung samples (Fig. 5, A and B, b1 and b2, and Table 1). Colocalization with well-characterized cell type markers for epithelial cells (cytokeratin) demonstrated PCNA-positive cells in the cytokeratin-expressing cells (Fig. 5B, b3–b6). The abundant PCNA immunostaining in keratin-expressing cells is consistent with epithelial proliferation following CCL11 treatment.

Fig. 5.

Effects of exogenous CCL11 on organ explant cultures prepared from 3 developing lung tissue samples with gestational ages 17, 21, and 23 wk, each culture subdivided into 3 and treated with 0, 12, and 120 nM CCL11. A: box plot demonstrating median, 25–75% interquartile range, and 95% confidence intervals following CCL11 treatment. Area percent of occupied by cells immunopositive for PCNA was used to assess the effects of CCL11 treatment on the explant cultures. Bars indicate 95% confidence intervals. B, b1: PCNA immunostaining in untreated explant culture prepared from 17-wk developing lung. Magnification, ×200. b2: PCNA immunostaining in explant culture prepared from 17-wk developing lung and treated with 12 nM eotaxin daily for 5 days. Magnification, ×200. b3–b6: Immunostaining in 23-wk developing lung treated with 120 nM CCL11 for 5 days showing cells immunopositive (b3, red) for PCNA, a proliferation marker, in the same area as cells immunopositive (b4, gray-blue) for cytokeratin, an epithelial cell marker. Colocalization confirmed by double staining for PCNA and cytokeratin shown in b5. Magnification, ×200. b6: High power detail of double stain shown in b5 with straight arrows indicating cells staining only for cytokeratin and curved arrows indicating cells double-stained for PCNA and cytokeratin. Magnification, ×1,000.

View this table:
Table 1.

Increased proliferation following treatment of lung tissue explant cultures with exogenous CCL11

Signaling cascade activation following eotaxin-1 treatment of organ explant cultures.

Signaling transduced by CCR3 can involve activation of ERK1/2 (10, 29), a member of the MAPK signaling cascade. We compared the abundance of the activated (phosphorylated) form of ERK1/2 in the explant cultures as a function of treatment with CCL11 using a specific antibody. ANOVA on ranks showed that the percentage of area that was positive for ERK1/2 staining was significantly greater after treatment with CCL11 [Fig. 6, a and b; P < 0.05; 3.6 (2.5–96)-fold increase after 12 nM CCL11, 1.5 (0.09–14) after 120 nM CCL11, median fold increase and interquartile range]. Representative ERK1/2 immunostaining for untreated explant culture is shown in Fig. 6c and for explant culture treated with CCL11 in Fig. 6d.

Fig. 6.

ERK activation in CCL11-treated organ explant cultures. a: Box plot showing median, 25–75% interquartile range, and 95% confidence interval for area percent ERK1/2 immunopositivity following 5-day treatment with CCL11 at 0, 12, and 120 nM. Black dots indicate 95% confidence intervals. Area percent ERK1/2 immunostaining increased significantly (*P < 0.05) following 12 nM CCL11 treatment compared with untreated cultures. b: Effects of CCL11 greatest at 12 nM, as shown by box plot demonstrating fold increase in ERK1/2 immunostaining. Plot shows median, 25–75% interquartile range, and 95% confidence intervals (black dots). Fold increase in area percent ERK1/2 immunostaining significantly increased (**P < 0.001) compared with untreated cultures for both 12 and 120 nM CCL11. c: Representative immunostaining for phosphorylated ERK1/2 in untreated explant culture prepared from 17-wk developing lung. Magnification, ×200. d: Representative immunostaining for phosphorylated ERK1/2 in 12 nM CCL11-treated explant culture prepared from 17-wk developing lung, demonstrating significantly increased (P < 0.05) abundance of immunopositive cells compared with untreated culture. e: Representative immunostaining for phosphorylated ERK1/2 in developing human lung tissue sample with gestational age 21.5 wk. Magnification, ×100. f: No immunostaining was detected in same area of the lung tissue sample shown in e following substitution of the primary antisera with irrelevant IgG. Magnification, ×100. gj: Colocalization of ERK1/2 immunostaining with cytokeratin, an epithelial marker in developing human lung. g: ERK1/2 immunostaining (red) in 22-wk developing human lung. Magnification, ×200. h: cytokeratin immunostaining (blue-gray) in a serial section of 22-wk developing human lung. Magnification, ×200. i: Serial section in 22-wk developing human lung confirming colocalization of ERK1/2 and cytokeratin immunostaining confirmed with double stain. Magnification, ×200. j: High power detail of double stain shown in i, demonstrating epithelial cells immunopositive for only cytokeratin (arrows) and double stained for ERK1/2 and cytokeratin (curved arrows). Magnification, ×1,000.

To test for possible affects of the lung explant culture process itself on the expression and activation of ERK1/2, we also analyzed the expression of phosphorylated ERK1/2 in paraffin-embedded developing lung tissue samples with gestational ages between 10–23 wk. We randomly selected 12 of the 17 samples that had demonstrated immunopositivity for CCL11 and tested them for expression of ERK1/2. Immunostaining demonstrated ERK1/2 in all of these samples (Fig. 6e). No immunostaining was appreciated following substitution of the primary antisera by an irrelevant IgG (Fig. 6f). Immunopositivity for ERK1/2 was abundant in cells expressing the epithelial marker cytokeratin (Fig. 6, g and h). Colocalization of ERK1/2 and cytokeratin was confirmed using double staining (Fig. 6, i and j).

Immunostaining for ERK1/2 in fetal lung tissue culture treated with CCL11 primarily localized to the airway epithelium and mesenchymal substructures where proliferation was also seen (Fig. 7, a and b), consistent with activation of ERK1/2 in the same cell types demonstrating increased proliferation following CCL11 treatment. The ERK1/2 immunostaining in the lung tissue samples predominantly colocalized with cytokeratin immunostaining (Fig. 7, df), consistent with epithelial cell expression. Thus the epithelium was the site of the most abundant CCL11 expression in the lung tissue samples, the greatest amount of proliferation following CCL11 treatment in developing lung explant cultures, and showed immunopositivity for the activated form of one of the signaling cascades associated with CCL11 responses (Fig. 7, af).

Fig. 7.

Epithelial cells have the greatest abundance of CCL11 immunostaining in developing human lung and show the majority of the proliferative response and ERK1/2 activation following CCL11 treatment in developing lung explant cultures. ac: Representative immunostaining (arrows) in organ explant cultures prepared from 17-wk developing human lung treated with 120 nM eotaxin-1 showing PCNA staining (a) colocalizing with phosphorylated ERK1/2 (b) and cytokeratin (c). df: Representative immunostaining (arrows) in 21.5-wk developing human lung showing CCL11 expression (d) colocalizing with phosphorylated ERK (e) and cytokeratin (f). Magnification, ×200. V, vessel.

DISCUSSION

This study demonstrates that developing human lung expresses the mRNA for CCL11, CCL24, CCL26, and CCR3. Additionally, our study shows that the immature human lung expresses the protein for CCL11. Whereas the eotaxins were detected in our samples, eosinophils were not detected in the developing lung tissue samples used in these studies. Thus our study extends previous investigations demonstrating functioning of the eotaxin/CCR3 system in processes without significant eosinophilia to the developing human lung. The absence of eosinophils despite expression of CCL11 and CCR3 has previously been reported in studies of vascular inflammation (7, 22) and suggests that this receptor-ligand system has a function other than the recruitment of eosinophils in developing lung.

We defined the spatial and temporal expression of CCL11 and the temporal expression of CCL24, CCL26, and CCR3 in developing human lung. In our samples, the abundance of CCL11 directly correlated with both gestational age and a family history of atopy and/or asthma. This suggests that the developing human lung regulates the expression of eotaxin, a necessary precondition for a functional role during lung development. Additionally, the trend toward a correlation of increased CCL11 expression with a maternal history of atopic disease suggests that some mediator abnormalities associated with asthma and atopy may predate the environmental exposures that are thought to drive eotaxin expression. Our findings support the speculation that activation of CCR3 during lung development could be permissive for postnatal lung disease.

The majority of the cells expressing CCL11 protein were airway epithelial cells, which are a major source of eotaxin in adult lung (9, 33, 39, 56, 76). Thus the mRNA for all the eotaxins and the eotaxin receptor are present in most normal human lung samples from both the first and second trimesters, which are important periods of growth and maturation for the developing lung. This differs from normal adult human lung. Although the mRNAs encoding CCL11 and CCL24 can be detected in normal human adult lung (17, 35, 74), the amount of protein appears to be minimal, with little to no detection by Western analysis (74), immunostaining (38, 74), or ELISA (65). In contrast, our data indicate that CCL11 protein can be detected in most samples of normal developing human lung. Our finding that CCR3 is constitutively expressed at low levels in the developing lung are similar to those reported for normal adult human lung (51, 76).

The coexpression of CCR3 and CCL11 suggests a functional role for the receptor-ligand system. In support of this hypothesis, we demonstrated that CCL11 treatment of lung tissue cultures increased PCNA-positive cells, together with phosphorylated ERK1/2, both of which were present predominantly in the epithelium. In fact, most of the PCNA-positive cells also expressed phosphorylated ERK1/2, consistent with activation of ERK1/2 in these cells. These findings indicate that midtrimester human fetal lung can respond to CCL11 by increasing proliferation and can activate an eotaxin-associated signaling cascade (ERK1/2). Limited tissue availability prevented us from performing blocking experiments that would have conclusively demonstrated that the exogenous CCL11 activated ERK1/2 in the explant cultures.

The present functional analysis was focused on changes in proliferation as a general indicator of responsiveness to CCL11, which, in the developing lung, is frequently inversely correlated with the expression of differentiation markers (63). Lungs of gestational age greater than 21 wk expressed low levels of CCR3 and were less responsive to treatment with CCL11. Cumulatively, these observations suggest that CCL11 activates CCR3 receptors on the epithelium of the developing lung in a manner that facilitates expansion and may modulate airway development. Since the range of CCL11 concentrations used in the lung tissue culture studies included 100 nM, affects at either CCR5 or CCR2 cannot be excluded from the present studies (50). However, since the maximal effects on proliferation were seen at 10 nM CCL11, it is likely that the proliferation effects observed in our culture studies were due to CCR3 activation.

This role for the eotaxin/CCR3 system is consistent with the role that another cytokine, TNF-α, plays in the developing lung. TNF-α is constitutively expressed in embryonic murine lung (32), and TNF-α treatment of murine lung bud cultures increases branching morphogenesis (27). Similar to the findings in mice deficient in one or more eotaxins (54, 59, 73), TNF-α is not critical for lung development since TNF-α null mice have unremarkable adult baseline pulmonary histology (43).

Our study expands to the lung prior investigations regarding the roles of the eotaxins in development. CCL11 has also been shown to modulate the development of other organ systems, such as the murine mammary gland, where this chemokine is required for normal branch development (19). Additionally, CCL11 modulates murine fetal hematopoiesis, including the development of myeloid precursors and mast cells (55).

Previous investigations examining the overexpression of CCL11 in mice focused on the effects of overexpression in the adult lung either transiently (47, 48) or selectively in the type II cells (47). Neither pattern of CCL11 overexpression altered lung histology, although the effects of the transgene on bronchiolar epithelial cells, a major site of eotaxin expression in our study, were not detailed in these studies.

Characterization of neither CCL11-deficient mice (59, 73) nor CCL11- and CCL24-deficient mice (54) showed a baseline lung abnormality. However, the eotaxins have largely overlapping actions (6, 8, 13, 31, 33, 37, 44, 69, 74), and our study demonstrates that the immature lung expresses all three eotaxins during development. It is possible that increased expression of either CCL24 or CCL26 might have obscured the effects of CCL11 or the combined CCL11 and CCL24 deficiency. Alternatively, whereas the eotaxins may not be required for normal pulmonary organogenesis, they could nonetheless contribute to the regulation of lung development. Such functional redundancy is observed with multiple growth factors that stimulate growth and maturation of developing fetal lung (21, 43, 66). Our data support a functional role for the eotaxins in human lung development.

Deficiency of CCR3 has also been examined in the mouse model (26). These mice demonstrate increased airway responsiveness to methacholine challenge compared with wild-type animals following intraperitoneal ovalbumin sensitization and aerosolized challenge. This study did not examine the effects of CCR3 deficiency on the epithelium in detail. Our study shows that this receptor-ligand system can support proliferation of the epithelium of the developing human lung.

In conclusion, this study demonstrates that CCL11 and its receptor, CCR3, are expressed by developing human lung, an environment containing few if any eosinophils. In vitro studies with organ cultures demonstrate increased cell proliferation following CCL11 treatment and activation of an eotaxin-associated signaling cascade, consistent with functionality of this system in these cells. Cumulatively, our observations support the hypothesis that CCL11 activates the CCR3 receptor on developing lung epithelial cells to facilitate their proliferation and growth. Thus our data support the postulate that the eotaxin-CCR3 receptor-ligand system has a role in human lung development that is distinct from its established role in inflammatory cell recruitment.

GRANTS

This study was funded by National Institutes of Health Award 5K08HL067910 (K. J. Haley).

Footnotes

  • The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

REFERENCES

  1. 1.
  2. 2.
  3. 3.
  4. 4.
  5. 5.
  6. 6.
  7. 7.
  8. 8.
  9. 9.
  10. 10.
  11. 11.
  12. 12.
  13. 13.
  14. 14.
  15. 15.
  16. 16.
  17. 17.
  18. 18.
  19. 19.
  20. 20.
  21. 21.
  22. 22.
  23. 23.
  24. 24.
  25. 25.
  26. 26.
  27. 27.
  28. 28.
  29. 29.
  30. 30.
  31. 31.
  32. 32.
  33. 33.
  34. 34.
  35. 35.
  36. 36.
  37. 37.
  38. 38.
  39. 39.
  40. 41.
  41. 42.
  42. 43.
  43. 44.
  44. 45.
  45. 46.
  46. 47.
  47. 48.
  48. 49.
  49. 50.
  50. 51.
  51. 52.
  52. 53.
  53. 54.
  54. 55.
  55. 56.
  56. 57.
  57. 58.
  58. 59.
  59. 60.
  60. 61.
  61. 62.
  62. 63.
  63. 64.
  64. 65.
  65. 66.
  66. 67.
  67. 68.
  68. 69.
  69. 70.
  70. 71.
  71. 72.
  72. 73.
  73. 74.
  74. 75.
  75. 76.
View Abstract