Table 1.

Primers used in real-time PCR

PrimerSequence
GAPDH
    ForwardCTGCCGCCTGGAGAAACCT
    ReverseGCTGTAGCCAAATTCATTGTCG
ICAM-1
    ForwardCAGTGTTGCCTGTGATGGAAA
    ReverseCTTCAGTCTTGTGCCAGTGAGTCT
MCP-1
    ForwardCCAGCAGCAAGTGTCCTAAAG
    ReverseTTTTCTTGTCCAGGTGGCTTAT
IL-8
    ForwardGCATAAATACGCATTCCACA
    ReverseCAGGCAGACCTCTTTTCCAT
MPO
    ForwardAAGCCAGGAAGATTGTGGGA
    ReverseAGGTGAAGGGTTGGATGAGG
IL-1β
    ForwardTCTGCCCTGTACCCCAACTG
    ReverseCCCAGGAAGACGGGCTTT
IL-6
    ForwardCTGCTTCTGGTGATGGCTACTG
    ReverseGGCATCACCTTTGGCATCTT
IL-10
    ForwardGGAGAAGCTGAAGACCCTCA
    ReverseGATATCAAACTCACCCGTGG
TNF
    ForwardCGTTGTAGCCAATGTCAAAGCC
    ReverseTGCCCAGATTCAGCAAAGTCCA
  • MCP-1, monocyte chemoattractant protein-1; MPO, myeloperoxidase.